GAT-B 2023 Question Paper with Answer Key

What type of modulation is used in television transmission?

1. Aamplitude modulation
2. Bfrequency modulation
3. Cboth amplitude and frequency modulation
4. Dno modulation is required

The potential energy U(r) of two point charges at a distance of r is proportional to

1. A−1/r
2. B1/r²
3. C1/r³
4. D1/r

Which one of the following is the working principle behind optical fibers?

1. AReflection
2. BRefraction
3. CDiffraction
4. DTotal internal reflection

The mean square speed (<v²>) of the molecules of a gas at absolute temperature T is proportional to

1. A1/T
2. B√T
3. CT
4. DT²

Two sources are called coherent if they produce waves

1. Aof equal wavelength
2. Bof equal velocity
3. Chaving a constant phase difference
4. Dhaving same shape of wavefront

The electric field due to a dipole along the line passing through its midpoint and perpendicular to its axis is proportional to

1. A1/r²
2. B1/r³
3. C1/r
4. Dr

A satellite is revolving around the Earth at some height (h). If R is the radius of orbit, then the time period of satellite is proportional to

1. A(R+h)³
2. B(R+h)^3/2
3. C(R+h)^5/2
4. D(R+h)⁶

The moment of inertia of a uniform hollow sphere about its diameter is

1. AMR²
2. BMR²/2
3. C2/3 MR²
4. D3/2 MR²

A pseudoplastic fluid is best characterized by

1. AIncrease in apparent viscosity as the shear rate increases
2. BDecrease in apparent viscosity as the shear rate increases
3. CThe structure breaks down and apparent viscosity decreases with continuous shear stress
4. DThe structure builds up and apparent viscosity decreases with continuous shear stress

A wedge of 60° representing one sixth portion of a circular disc of mass M and radius R is cut. It is rotated about a line perpendicular to its plane and passing through the centre of the original disc. Its moment of inertia about the axis of rotation is:

1. A1/2 MR²
2. B1/8 MR²
3. C√2 MR²
4. D1/12 MR²

Half-life (T_½) of a radioisotope is related to decay constant (λ):

1. AT_½ = 0.693/λ
2. BT_½ = e^−λ
3. CT_½ = −λNdt
4. DT_½ = −λe^−t

Which of the following are not electromagnetic waves?

1. ACosmic ray
2. BX-ray
3. Cβ-ray
4. Dα-ray

The gravitational force exerted by earth on a particle as it travels from the earth’s surface towards the core

1. Aincreases
2. Bis zero
3. Cdecreases
4. Dremains same

The S.I. unit of Luminous Intensity.

1. AJoule
2. BWatt
3. CMole
4. DCandela

To obtain p-type Si semiconductor, we need to dope pure Si with

1. AOxygen
2. BAluminium
3. CPhosphorous
4. DGermanium

Blister copper is given its name because of the evolution of

1. AH₂
2. BCO₂
3. CSO₂
4. DCl₂

Which of the following alloys do NOT have copper as one of the constituent metal?

1. ABrass
2. BGerman Silver
3. CBronze
4. DSolder

Which of the following is a component of smoke screens?

1. APhosphine
2. BCalcium carbide
3. CCopper phosphide
4. DCalcium phosphate

Match List – I with List – II.

Choose the most appropriate match from the options given below:

1. AA-III, B-II, C-I, D-IV
2. BA-III, B-IV, C-I, D-II
3. CA-III, B-II, C-IV, D-I
4. DA-II, B-I, C-IV, D-III

The reaction between sodium hydroxide and ester of fatty acid is

1. AEsterification
2. BPyrophosphorolysis
3. CSaponification
4. DNeutralization reaction

The deficiency of which vitamin in the body causes Pernicious Anaemia?

1. AVitamin B₆
2. BVitamin B₁
3. CVitamin B₁₂
4. DVitamin B₂

In areas with low air pollution, rain water generally has a pH of ~5-6 because of

1. AH₂SO₄
2. BH₂CO₃
3. CHNO₃
4. DHNO₂

What will be the order of acidity of the following acids, starting with the highest?

1. AI > II > III
2. BII > I > III
3. CI = III > II
4. DIII > II > I

Which of the following is not isoelectronic with Na⁺?

1. AO₂⁻
2. BMg⁺²
3. CAl⁺³
4. DF⁻

Calculate the molality of 3.0 g acetic acid in 100 g of benzene.

1. A0.05 mol kg⁻¹
2. B0.5 mol kg⁻¹
3. C2.0 mol kg⁻¹
4. D0.2 mol kg⁻¹

You are supplied with a pain-relieving drug (MW 300) formulation at 5 mg/ml. A patient with a plasma volume of 2.5 L needs an initial dose of 20 μM for immediate relief. How much solution do you need to inject to the patient?

1. A1 ml
2. B2 ml
3. C3 ml
4. D4 ml

The reactive functional group in coenzyme Q is

1. Aester
2. Bcarboxylic acid
3. Cketone
4. Dthioester

Consider the two compounds given below:

Which of the following best describes the relationship between them?

1. AResonance structures
2. BPositional isomers
3. CFunctional isomers
4. DTautomers

The conversion of FAD to FADH₂ is a

1. AOne-step process with radical intermediates
2. BTwo-step process with ionic intermediates
3. CTwo-step process with radical intermediates
4. DOne-step process with ionic intermediates

Identify A in the following reaction:

1. A
2. B
3. C
4. D

Match List – I with List – II.

Choose the correct answer from the options given below:

1. AA-IV, B-III, C-I, D-II
2. BA-IV, B-I, C-II, D-III
3. CA-III, B-II, C-I, D-IV
4. DA-III, B-I, C-II, D-IV

What is Totipotency?

1. AThe capacity to generate a whole seed from any cell or explant.
2. BThe capacity to generate plants with higher levels of vitamins and healthier fats.
3. CThe capacity to generate somatic hybrids from the naked protoplasts of two different cells.
4. DThe capacity to generate a whole plant from any cell or explant.

Match List – I with List – II.

Choose the most appropriate match from the options given below:

1. AA-II, B-III, C-IV, D-I
2. BA-I, B-II, C-IV, D-III
3. CA-IV, B-III, C-I, D-II
4. DA-II, B-I, C-III, D-IV

Match List – I with List – II.

Choose the most appropriate match from the options given below:

1. AA-III, B-I, C-IV, D-II
2. BA-I, B-II, C-IV, D-III
3. CA-III, B-I, C-II, D-IV
4. DA-IV, B-I, C-II, D-III

Match List – I with List – II.

Choose the most appropriate match from the options given below:

1. AA-IV, B-III, C-I, D-II
2. BA-I, B-III, C-II, D-I
3. CA-II, B-IV, C-II, D-I
4. DA-IV, B-II, C-III, D-I

Which one of the following is an autosomal dominant disorder?

1. AMyotonic dystrophy
2. BPhenylketonuria
3. CHemophilia
4. DThalassemia

Identify the correct statement with respect to linkage and recombination frequency.

1. AIf the genes are loosely linked they show low recombination frequency
2. BTwo genes with 1.3 percent recombination frequency are loosely linked
3. CIf the genes are tightly linked they show high recombination frequency
4. DIf the genes are tightly linked they show low recombination frequency

Given below are two statements: one is labelled as Assertion (A) and the other is labelled as Reason (R).

Assertion (A): Morgan observed that the Drosophila genes for yellow body and white eye showed 1.3 percent recombination frequency.Reason (R): Sturtevant used the frequency of recombination between gene pairs on the same chromosome as a measure of the distance between genes.

In the light of the above statements, choose the most appropriate answer from the options given below:

1. ABoth A and R are correct and R is the correct explanation of A
2. BBoth A and R are correct but R is not the correct explanation of A
3. CA is correct but R is not correct
4. DA is not correct but R is correct

Which is the site of attachment of spindle fibres to chromosomes during metaphase of mitosis?

1. AKinetoplast of chromosomes
2. BKinetoplast and chromatid arms
3. CSister chromatids of chromosomes
4. DKinetochores of chromosomes

The separation and purification of the biological product after completion of the biosynthetic stage in a bioprocess is known as

1. ADownstream processing
2. BUpstream processing
3. CQuality control testing
4. DSample processing

How are healthy plants recovered from diseased plants using plant tissue culture?

1. ABy growing floral buds of diseased plants in vitro
2. BBy growing leaf epidermis of diseased plants in vitro
3. CBy growing apical and axillary meristem of diseased plant in vitro
4. DBy growing phloem parenchyma cells of diseased plant in vitro

Plants which are genetically identical to the original plant from which they are grown are called as

1. ASomatic hybrids
2. BSomaclones
3. CSingle cell explants
4. DHomozygous twins

Drosophila melanogaster is suitable for genetic studies because

A. male and female flies are easily distinguishable

B. the life cycle is completed in about three weeks

C. a single mating produces large progeny

D. phenotypic variations can be seen with low magnification microscope

Choose the correct answer from the options given below:

1. AA and B only
2. BC and D only
3. CA, C and D only
4. DB, C and D only

Find the least number which when divided by 16, 18, 20 and 25 leaves 4 as remainder in each case but when divided by 7 leaves no remainder.

1. A8004
2. B13004
3. C18004
4. D18014

Which of the following is NOT a secondary lymphoid organ?

1. ALymph nodes
2. BSpleen
3. CPeyer’s patches
4. DBone Marrow

Which two gases together contribute maximally to global warming?

1. ACO₂ + N₂O
2. BCH₄ + CFCs
3. CCO₂ + CFCs
4. DCO₂ + CH₄

The ratio of the incomes of two persons is 9:7 and the ratio of their expenditure is 4:3. If each of them manages to save Rs. 2000/- per month, find their monthly income.

1. A9,000/- & 7,000/-
2. B10,500/- & 13,500/-
3. C10,800/- & 8,400/-
4. D18,000/- & 14,000/-

The perimeter of the top of a rectangular table is 28 m, whereas its area is 48 m². What is the length of its diagonal?

1. A5 m
2. B10 m
3. C12 m
4. D12.5 m

Triangle ABC is a right angled triangle, right angled at B. If lengths of AB and BC are 60 cm and 80 cm respectively, and BD is an altitude of triangle ABC, then find the length of AD in cm.

1. A34
2. B36
3. C40
4. D42

Ramesh has four friends. In how many ways can he invite one or more of them for dinner?

1. A15
2. B11
3. C16
4. D20

Robin could get equal number of Rs. 55, Rs. 85 and Rs. 105 category tickets for a movie. He spent Rs. 2940 for all the tickets. How many tickets of each category did he buy?

1. A12
2. B14
3. C16
4. D11

Pipe A can fill a tank three times faster than Pipe B. If together the two pipes can fill the tank in 36 minutes, then Pipe B alone will be able to fill the tank in

1. A81 minutes
2. B108 minutes
3. C144 minutes
4. D192 minutes

Rohit has some hens and some goats. If the total number of animals is 90 and the total number of animal feet is 248. What is the total number of goats Rohit has?

1. A32
2. B36
3. C34
4. D30

Which two operation signs need to be interchanged to make the following equation correct?

73 − 13 × 42 ÷ 14 + 56 = 56

1. A+ and ×
2. B× and ÷
3. C− and +
4. D− and ×

A man spends 75% of his income. If his income increases by 20% and his expenditure increases by 10%, then the percentage of increase in his saving would be

1. A40%
2. B30%
3. C50%
4. D25%

A basket contains 4 red, 5 blue and 3 green marbles. If 3 marbles are picked at random, what is the probability that either all are green or all are red?

1. A7/44
2. B7/12
3. C5/12
4. D1/44

Which of the following represents the equation of a straight line passing through origin?

1. A2x − 3y = 0
2. B5x − 4 = 0
3. C2y − 13 = 0
4. Dx + 2y + 9 = 0

A fraction becomes 9/11 if 2 is added to both the numerator & the denominator. If 3 is added to both the numerator and denominator, the fraction becomes 5/6. Find the fraction.

1. A7/9
2. B2/3
3. C7/11
4. D8/9

A 10 m long ladder reaches a window 8 m above the ground. Find the distance of the ladder from the base of the wall.

1. A7 m
2. B6 m
3. C10 m
4. D5 m

Two fair cubical dice with faces numbered from 1 to 6 are rolled. What is the probability that the sum of the numbers on the two faces that appear on the top is 8, given that each of the two faces that appear on the top shows an odd number?

1. A1/18
2. B2/9
3. C5/36
4. D1/9

Which of the following bacterium is generally used in plant genetic engineering?

1. AThermus aquaticus
2. BPseudomonas syringae
3. CAgrobacterium tumefaciens
4. DEscherichia coli

Which of the following is NOT a preparative purification method for recovering protein product after fermentation?

1. AGel filtration chromatography
2. BIon exchange chromatography
3. CThin Layer chromatography
4. DAffinity chromatography

Sterilization of fermentation media with steam is performed at

1. A100 °C for 30 minutes
2. B150 °C for 5 minutes
3. C121 °C for 10 minutes
4. D121 °C for 20 minutes

Which of the following is a bacteria known for high yield of ethanol production?

1. ASaccharomyces cerevisiae
2. BPseudomonas aeruginosa
3. CZymomonas mobilis
4. DAcetobacter aceti

In a typical bacterial growth curve, the phase in which cells adapt to growth condition and are metabolically active but not able to divide is:

1. AStationary phase
2. BLag phase
3. CExponential phase
4. DDeath phase

Which of the following is generally NOT a primary metabolite?

1. AAmino acids
2. BPolysaccharides
3. CAntibiotics
4. DVitamins

Vaccination in the last century had resulted in 100% reduction in active cases across the globe for

1. Asmall pox
2. Bhepatitis B
3. Ctetanus
4. Dtuberculosis

Charles Richet was awarded Nobel Prize in Physiology or Medicine for his seminal discovery of

1. Aimmunoglobulins
2. Bhypersensitivity
3. CmRNA vaccines
4. Dmalaria vaccine

Match List I with List II

Choose the correct answer from the options given below:

1. AA-III, B-I, C-II, D-IV
2. BA-IV, B-II, C-III, D-I
3. CA-II, B-III, C-IV, D-I
4. DA-IV, B-III, C-II, D-I

Which of the following is a multinucleated cell present in the bones of human body?

1. ACartilage
2. BOsteoclasts
3. COsteoblast
4. DOsteocyte

Neurotransmitters can be either excitatory or inhibitory, depending on where they are released, what receptors they bind to, and the ionic conditions that they encounter. Which of the following is a group of excitatory neurotransmitters?

1. AGlycine and Glutamate
2. Bγ-aminobutyric acid (GABA) and Glycine
3. CGlutamate, Acetylcholine and Serotonin
4. Dγ-aminobutyric acid (GABA) and Serotonin

Match List I with List II

Choose the correct answer from the options given below:

1. AA-II, B-III, C-IV, D-I
2. BA-III, B-IV, C-I, D-II
3. CA-IV, B-I, C-II, D-III
4. DA-III, B-II, C-I, D-IV

Which of the following statement is NOT true about the seed culture of Orchids?

1. AThey grow on salt poor medium as mineral requirement is low
2. BProtocorm like structure is formed from the embryo
3. CSeeds are very small and contain little or no food reserve
4. DIn vitro germination and development is very slow in Orchids

Which of the following is a dominant genetic trait in humans?

1. AAlkaptonuria
2. BSickle cell anemia
3. CHuntington’s disease
4. DPhenylketonuria

The structural gene lac A in the Lac operon is responsible for

1. Aprevent entry of glucose into the bacterial cell
2. Bconversion of disaccharide sugar into their monosaccharides
3. Cconversion of lactose to allolactose
4. Dremoval of toxic byproducts of lactose digestion

Which one of the following is incorrect about DNA microarray?

1. AIt is used for transcriptome analysis
2. BIt is used to identify expression of microRNAs only
3. CAll the expressed genes of a sample can be analyzed simultaneously
4. DIt can qualitatively as well as quantitatively analyze the expression of particular mRNA

Xeroderma pigmentosum, an autosomal recessive disorder, is caused due to defects in

1. ANucleotide Excision Repair Pathway
2. BBase Excision Repair Pathway
3. CDouble Strand Break Repair Pathway
4. DHomologous Recombination Repair Pathway

Which of the following is NOT correct about mutagenesis using a chemical mutagen?

1. ALow frequency of mutations in the gene of interest
2. BInability to confirm the location of the causal mutation even after getting the desired phenotype
3. CCreation of point mutations at a specific position in the gene of interest
4. DAnalysis of a large number of offspring is required to isolate the desired mutant

Which of the following could be a recognition site of a Type IIp restriction endonuclease?

1. A5’-TTAACCGGAA-3’
2. B5’-GCTAATAGC-3’
3. C5’-TTTAATTAAA-3’
4. D5’-CCCTATAGG-3’

Which of the following is desirable in a primer for PCR?

1. AShould always be more than 50 nucleotides in length
2. BSecondary structures such as hairpins
3. CSequences with stretches of identical single nucleotides
4. DMinimal complementarity between reverse and forward primers

Which of the following is a heteropolysaccharide?

1. AChitin
2. BDextran
3. CAgarose
4. DGlycogen

Match List I with List II

Choose the correct answer from the options given below:

1. AA-III, B-II, C-IV, D-I
2. BA-IV, B-III, C-II, D-I
3. CA-II, B-III, C-IV, D-I
4. DA-III, B-IV, C-I, D-II

Which of the following is NOT a PCR based method?

1. ASelective Amplification of Microsatellite Polymorphic Loci (SAMPL)
2. BSequence Tagged Site (STS) Amplification
3. CRandom Amplification of Polymorphic DNA (RAPD)
4. DRestriction Fragment Length Polymorphism (RFLP)

Which of the following statement is NOT correct with respect to Cybrids?

1. AThey are the resultants of spontaneous fusion of protoplasts obtained from common callus culture
2. BThey allow the direct transfer of cytoplasmic male sterility (CMS) from donor to recipient
3. CThe process can bypass up to 12 backcrosses required in development of alloplasmic lines
4. DIt is a fusion of protoplast of one parent and cytoplast of the second.

Find the odd one out with respect to pleotropic gene expression:

1. AWhite eye gene in Drosophila
2. BFlower color gene in Pisum sativum
3. CMarfan’s Syndrome
4. DPlumage color in poultry

In which stage of HIV infection does one usually show symptoms of AIDS:

1. AWithin 15 days of sexual contact with an infected person
2. BWhen the infected retrovirus enters the host cell
3. CWhen HIV damages a large number of helper T-Lymphocytes
4. DWhen the viral DNA is produced by reverse transcriptase

Given below are two statements:Statement I: Orthologs are sequences from different organisms or genomes derived from speciation events while paralogs are sequences from the same organism or genome, which are derived from gene duplication events rather than speciation events.Statement II: Both orthologs and paralogs are homologous sequences

In the light of the above statements, choose the correct answer from the options given below-

1. ABoth Statement I and Statement II are true
2. BBoth Statement I and Statement II are false
3. CStatement I is correct but Statement II is false
4. DStatement I is incorrect but Statement II is true

The approximate length of the open reading frame coding for a 55 kDa bacterial protein will be

1. A5000 nucleotides
2. B5500 nucleotides
3. C1500 nucleotides
4. D3000 nucleotides

Which of the following is NOT a multiple sequence alignment program?

1. ACLUSTALX
2. BAMBER
3. CCLUSTALW
4. DPILEUP

Given below are two statements:

Statement I: Protein-ligand docking involves binding of a small molecule to the protein receptor.Statement II: Both AUTODOCK and LUDI are protein-ligand docking programs

In the light of the above statements, choose the correct answer from the options given below

1. ABoth Statement I and Statement II are true
2. BBoth Statement I and Statement II are false
3. CStatement I is correct but Statement II is false
4. DStatement I is incorrect but Statement II is true

EST stands for

1. AEukaryotic Sequencing Technology
2. BExpressed Sequence Tag
3. CEukaryotic Sequence Test
4. DEukaryotic Sequence Tag

Which of the following is a structurally independent three-dimensional unit associated with a particular functional role?

1. ADomain
2. BMotif
3. CStrand
4. DHelix

logP is a measure of drug-likeliness in Lipinsky’s Rule of Five. P denotes

1. Apartition coefficient
2. Bpolymer concentration
3. Cplasma coefficient
4. Dpyrogen concentration

A gene whose expression helps to identify transformed cell is known as

1. ARegulatory gene
2. BHousekeeping gene
3. CStructural gene
4. DSelectable marker

Which of the following exhibits maximum mobility in an agarose gel?

1. ANicked Plasmid DNA
2. BSupercoiled Plasmid DNA
3. CLinear Plasmid DNA
4. DSingle stranded Plasmid DNA

The purity of a plasmid DNA preparation is determined by analyzing the ratio A₂₆₀/A₂₈₀. In a pure DNA preparation, the ratio will be

1. Aclose to 2
2. Bclose to 1
3. Cless than 1
4. Dequal to 1

How much protein will you need to make 100 microlitres of 15 micromolar solution of a 95 kDa protein?

1. A0.1425 mg
2. B1.425 mg
3. C0.01425 mg
4. D14.25 mg

Information about the isoelectric point will be useful in the purification of a protein by which of the following chromatography techniques?

1. AGel Filtration chromatography
2. BIon exchange chromatography
3. CReverse phase chromatography
4. DHydrophobic interaction chromatography

To combat a severe viral infection, what kind of immune response should be elicited?

1. AInnate immune response only
2. BHumoral response only
3. CCell mediated immune response only
4. DBoth humoral and cell mediated immune response

A monoclonal antibody was heterologously expressed in E. coli and Chinese hamster ovary (CHO) cell line, and the recombinant proteins obtained were purified to homogeneity and were found to be structurally identical. However, the protein expressed in E. coli was not functionally active. The reason could be

1. AThe protein needs glycosylation for its function
2. BE. coli introduced phosphorylation which was detrimental for function
3. CCHO cells generally phosphorylate the heterologously expressed protein
4. DThere may be an inactivating ubiquitination modification in E. coli

The genome of Hepatitis B, a DNA virus, is unlikely to code for

1. ADNA dependent DNA polymerase
2. BRNA dependent DNA polymerase
3. CDNA dependent RNA polymerase
4. DEnvelope protein

Which of the following is generally NOT a step in PCR?

1. ADenaturation
2. BElongation
3. CAnnealing
4. DLigation

Which of the following is true for the free-energy change of a reaction (ΔG) catalyzed by an enzyme?

1. AA reaction can take place spontaneously only if ΔG is negative.
2. BIn a system at equilibrium, there is a net change in the concentrations of the products and reactants and ΔG is positive.
3. CThe ΔG of a reaction is dependent of the path of the transformation.
4. DThe ΔG provides information about the rate of a reaction.

Which of the following is correct about the endoplasmic reticulum?

1. AThe smooth endoplasmic reticulum is involved in glycosylating the proteins
2. BThe rough endoplasmic reticulum is involved in synthesis of proteins that will either be inserted into cellular membranes or be secreted from the cell
3. CThe lumen of rough endoplasmic reticulum is highly reducing in nature
4. DThe smooth endoplasmic reticulum synthesizes globular proteins and rough endoplasmic reticulum synthesizes fibrillar proteins

Which of the following DNA, in its double-stranded form, will have the highest Tm?

1. AATGTTGGACCTTGAGTAATGCTA
2. BAAAGGATTTCCCTTTGATCGTATG
3. CATTTACTAGATTACTAGTATTGATA
4. DGCTTATGTATACCGGTTAGATCG

Which one of the following amino acids contributes to the sulfur content in a protein?

1. AMethionine
2. BProline
3. CLeucine
4. DPhenylalanine

The equilibrium sedimentation experiments performed by Meselson and Stahl in 1957 demonstrated that

1. ADNA replication takes place in a semiconservative fashion
2. BDNA is double stranded
3. CDNA chains are antiparallel
4. DThe nucleotides in DNA contain sugar

Match list I with List II

Choose the most appropriate match from the options given below:

1. AA-I, B-II, C-III, D-IV
2. BA-II, B-I, C-IV, D-III
3. CA-III, B-IV, C-I, D-II
4. DA-IV, B-III, C-II, D-I

The degree of inhibition for an enzyme catalyzed reaction by an inhibitor is independent of substrate concentration. This is expected in case of

1. ACompetitive inhibition
2. BUn-competitive inhibition
3. CNon-competitive inhibition
4. DAllosteric inhibition

Which of the following bioprocess would yield maximum number of ATP per gram of the substrate consumed?

1. AAnaerobic catabolism of amylose
2. BAerobic catabolism of glucose
3. CAerobic catabolism of methanol
4. DAerobic catabolism of acetate

The theoretical RQ (respiratory quotient) for the complete oxidation of pyruvic acid will be

1. A1.2
2. B0.6
3. C0.8
4. D1.0

Match list I with List II

Choose the most appropriate match from the options given below:

1. AA-I, B-II, C-III, D-IV
2. BA-II, B-III, C-I, D-IV
3. CA-IV, B-III, C-I, D-II
4. DA-IV, B-III, C-II, D-I

The cell mass of E. coli can be chemically represented as CH_1.77O_0.49N_0.24. The degree of reduction for this biomass (based on available electrons) is

1. A6.50
2. B2.50
3. C3.47
4. D4.07

A culture of E. coli cells (1 ml) was diluted 10⁶ fold and 100 μl of this was used for plating. After 24 hours incubation, the number of colony forming units (CFU) was found to be 180. The CFU count of the original culture is

1. A1.8 × 10⁹ CFU/ml
2. B1.8 × 10⁶ CFU/ml
3. C1.8 × 10⁷ CFU/ml
4. D1.8 × 10⁸ CFU/ml

Which of the following biochemical techniques does not use antibody?

1. AELISA
2. BWestern blotting
3. CIsoelectric focusing
4. DImmuno-affinity chromatography

Fermentation of fruit juice to vinegar involves the use of

1. AYeast only
2. BYeast with lactic acid bacteria
3. CYeast with butyric acid bacteria
4. DYeast with acetic acid bacteria

Which of the following process involves the formation of nitrate from ammonia?

1. AAmmonification
2. BDenitrification
3. CNitrification
4. DNitrogen fixation

The distance between each turn in the helical strand of DNA is

1. A20 Å
2. B34 Å
3. C28 Å
4. D42 Å

Which of the following mineral elements play an important role in biological nitrogen fixation?

1. ACopper
2. BMagnesium
3. CMolybdenum
4. DZinc

Most bacteria require vitamins as

1. Agrowth factors
2. Benergy source
3. Ccarbon source
4. Dsource of electron donors

In a reaction, if P (product) is at a lower internal energy level than S (substrate), then the reaction is

1. AEndothermic
2. BExothermic
3. CHomothermic
4. DExomorphic

The electron transport system is present in the

1. AInner mitochondrial membrane
2. BOuter mitochondrial membrane
3. COuter chloroplast membrane
4. DMitochondrial matrix

Which is the most abundant protein in the entire biosphere?

1. ACollagen
2. BHaemoglobin
3. CProteases
4. DRibulose bisphosphate Carboxylase-Oxygenase

Trihydroxypropane is commonly known as

1. AGlycine
2. BGlyceride
3. CGlycerol
4. DGlycolide

Intine, the inner wall of pollen grain is made up of

1. ACellulose and Pectin
2. BCellulose and Lignin
3. CPectin and Sporopollenin
4. DSporopollenin and Cellulose

The “Microglial Cells” found in human brain, represent which of the following class of innate immune cells?

1. ANK cells
2. BMacrophages
3. CEosinophils
4. DNeutrophils

Which antibody is involved in Type I hypersensitivity reaction?

1. AIgM
2. BIgG
3. CIgE
4. DIgA

Which of the following antibody is used by immune complexes for complement activation?

1. AIgA
2. BIgM
3. CIgE
4. DIgD

Given below are two statements: one is labelled as Assertion A and the other is labelled as Reason R

Assertion A: Normally, the influenza virus changes its structure slightly for each passing year. Although, we are being exposed to these “modified” or slightly mutated and evolving influenza strains every year, we do not always come down with the flu-disease even if we have not received the yearly influenza vaccine. However, sometimes, we do get a really bad case of the flu, despite the fact that we have memory cells left from previous infections with the influenza virus.Reason R: This is a concept of original antigenic sin, which suggests that we only mount a primary response once we have exhausted the potential to use our memory cells to eradicate the infection. Since most of our first encounters with influenza will vary, the years in which “all” of the key influenza epitopes are significantly “new” to each of us will also vary. It is only in these years that we experience a new primary response to influenza virus, and therefore symptoms of the flu are most severe.

In the light of the above statements, choose the correct answer from the options given below

1. ABoth A and R are true and R is the correct explanation of A
2. BBoth A and R are true but R is NOT the correct explanation of A
3. CA is true but R is false
4. DA is false but R is true

A humanized murine antibody is one in which the

1. AHeavy and light chain are from humans.
2. BHeavy chain is from human and the light chain is from mouse
3. CLight chain is from human and the heavy chain is from mouse
4. DCDRs are from mouse and the other regions are from humans

Symptoms of an allergy attack can be prevented by

1. AReducing the number of helper T cells in the body
2. BBlocking the attachment of the IgE antibodies to the mast cells
3. CBlocking the attachment of cytotoxic cells to dendritic cells.
4. DReducing the number of natural killer cells.

BCG vaccine is an example of

1. ALive attenuated vaccine
2. BHeat killed vaccine
3. CRecombinant vaccine
4. DSubunit vaccine

Cytokine released in response to virus infection is termed as

1. AInterleukin
2. BInterferon
3. CMonokine
4. DLymphokine

Which of the following is the least abundant immunoglobulin class in a normal adult?

1. AIgG
2. BIgE
3. CIgM
4. DIgA

Which of the following is normally used to determine the frequency of interferon gamma producing cells in a blood sample?

1. AELISPOT
2. BELISA
3. CImmunoprecipitation
4. DConfocal microscopy

Which is NOT a part of mandatory design considerations of a Rotating Biological Contactor (RBC) system?

1. AStaging of the RBC units and Secondary clarifier design
2. BLoading criteria
3. CEffluent characteristics
4. DRotation speed

Which of the following is NOT an example of bioremediation?

1. ACleaning of oil spills by Pseudomonas putida
2. BDecomposition of DDT by Acetobacter aerogenus
3. CRemoval of metal pollutants by Pseudomonas species
4. DDepletion of ozone by Aspergillus niger

The study of various atmospheric parameters is called

1. AGeology
2. BHydrology
3. CMeteorology
4. DEnvironmental Biology

Which of the following statements are NOT true for photochemical smog?

1. AIt is called oxidizing smog
2. BIts main component is SO₂
3. CIt occurs in warm and dry climate
4. DIt is formed due to burning of fossil fuels

Harmful gases such as SO₂ can be removed from the industrial exhaust using

1. ACatalytic convertor
2. BElectrostatic precipitator
3. CEarmuffs
4. DScrubber

Which of the following is true for a water sample with BOD value of more than 50 ppm?

1. AThe DO content would be less than 6 ppm
2. BThe water is clean
3. CThe amount of organic matter is very less
4. DThe aquatic life will be thriving

The issue of pesticide contamination of carbonated drinks was brought into limelight by which of the following NGO?

1. ACentre for Science and Environment
2. BBombay Natural History Society
3. CGreen Peace
4. DKalpavriksh

Anaerobic digestion proceeds in 4 steps. Which of the following represents the correct order of these four steps?

1. AHydrolysis → Acetogenesis → Acidogenesis → Methanogenesis
2. BHydrolysis → Acidogenesis → Acetogenesis → Methanogenesis
3. CMethanogenesis → Acidogenesis → Acetogenesis → Hydrolysis
4. DAcidogenesis → Hydrolysis → Acetogenesis → Methanogenesis

Which of the following factors DO NOT affect the operation of a trickling filter?

1. Aorganic loading
2. Bhydraulic flow rates
3. Ctemperature of the water and air
4. Dlinear flow velocity of the liquid

The UN Conference on Environment and Development (UNCED) is popularly known as

1. AMontreal protocol
2. BBasel conference
3. CParis conference
4. DEarth summit

Which of the following is an RNA virus?

1. ADengue virus
2. BSmall pox virus
3. CHuman Papilloma virus
4. DHepatitis B Virus

Which of these viruses make use of RNA-dependent DNA polymerase during replication?

1. AHIV
2. BDengue virus
3. CPolio virus
4. DHepatitis E virus

Which of the following viruses is likely to have the highest genomics mutation rate?

1. ASmall pox virus
2. BPolio virus
3. CHepatitis B Virus
4. DAdenovirus

Which of the following group of viruses generally infect plants?

1. ARetroviruses
2. BRiboviruses
3. CRheoviruses
4. DEnteroviruses

Which of the following is an enveloped virus?

1. ADengue virus
2. BPolio virus
3. CFoot and mouth disease virus
4. DAdenovirus

Which one of the following would, in general, NOT be a preferred choice for transgenic plants?

1. ATransgenic plants with higher levels of transgene expression
2. BTransgenic plants with single-copy insertion of the transgene
3. CTransgenic plants without any pleiotropic effects of the transgene
4. DTransgenic plants with integration of multiple copies of the transgene

Given below are two statements:

Statement I: The T-DNA region of a naturally occurring (native) Ti plasmid of Agrobacterium tumefaciens contains genes for biosynthesis of plant hormones.Statement II: The virulence genes of Agrobacterium tumefaciens are placed on a Helper Plasmid during development of a binary vector system for plant transformation.

In the light of the above statements, choose the correct answer from the options given below

1. ABoth Statement I and Statement II are true
2. BBoth Statement I and Statement II are false
3. CStatement I is correct but Statement II is false
4. DStatement I is incorrect but Statement II is true

Match List I with List II

Choose the correct answer from the options given below that is the best possible match of various components of plant tissue culture media (List I) and their role (List II):

1. AA-IV, B-III, C-II, D-I
2. BA-II, B-I, C-IV, D-III
3. CA-III, B-IV, C-I, D-II
4. DA-III, B-I, C-II, D-IV

The addition of silver nitrate in plant tissue culture media is useful for managing and minimizing detrimental effects of which of the following plant hormones?

1. ANAA
2. Bethylene
3. CGA-34
4. Dkinetin

Match List I with List II

Choose the correct answer from the options given below:

1. AA-IV, B-III, C-I, D-II
2. BA-IV, B-II, C-I, D-III
3. CA-III, B-I, C-IV, D-II
4. DA-III, B-IV, C-I, D-II

Which one of the following conditions would, in general, be more conducive for the production of roots from callus tissue of plants under in vitro conditions?

1. AHigher cytokinin/auxin ratio
2. BHigher auxin/cytokinin ratio
3. CLower auxin/cytokinin ratio
4. DRemoval of both auxin and cytokinin from the medium

The pH indicator used for animal cell culture media is

1. ACaCl₂
2. BPhenol red
3. CFetal Bovine Serum
4. DPhenolphthalein

The first clinical use of gene therapy was done for treatment of

1. APeptide deaminase deficiency
2. BAdenosine deaminase deficiency
3. CCytosine decarboxylate deficiency
4. DAdenosine demethylase deficiency

Which of the following is best suited to express large amount of glycosylated protein?

1. AE. coli
2. BM. smegmatis
3. CBaculovirus
4. DLambda Phage

Which of the following can be used for cell-line authentication?

1. ASerotyping
2. BVirus infection
3. CPCR
4. DProtein estimation