CSIR-NET Life Sciences June 2025 Question Paper with Answer Key and Solutions

On a spherical balloon of 10 cm radius, a circular colour patch has an area of 25 cm². If the balloon is uniformly expanded to a sphere of 50 cm radius, the area of the colour patch in cm² would be

1. 1125
2. 2625
3. 350
4. 4500

Average age of 20 students of a class is 10 years. Average age of these students together with their five teachers is 14. The age of Ramesh Sir, one of their five teachers, is exactly the same as the average age of all their five teachers. The sum of the ages (in years) of all the students and Ramesh Sir is

1. 1214
2. 2224
3. 3230
4. 4241

A pilgrim starts walking for a journey of 115 km. On the first day he covers 7 km, the next day 9 km, and likewise keeps adding 2 km everyday till he reaches 15 km per day which he maintains for the rest of the journey. How many days in all will he take to complete the journey?

1. 17
2. 28
3. 39
4. 410

A 2 cm wide wooden strip is to be fixed on a photo of 40 cm × 30 cm size all along its four sides. What is the minimum length of the wooden strip required?

1. 1124 cm
2. 2128 cm
3. 3132 cm
4. 4140 cm

The population of a town over the years 2000-2007 is shown in the given figure.

It can be inferred that during 2000-2007,

1. 1the population increased linearly
2. 2the rate of increase of the population increased linearly
3. 3the rate of increase of the rate of increase of the population increased linearly
4. 4the population increased exponentially

If any 9 papers are drawn from a both side printed book, the sum of their page numbers can NEVER be ______.

1. 19 × (9 + 1) / 2
2. 2divisible by 3
3. 3179
4. 4171

Which of the following is true?

1. 1π^ππ < e^ee < 3³³
2. 2π^ππ < 3³³ < e^ee
3. 33³³ < e^ee < π^ππ
4. 4e^ee < 3³³ < π^ππ

The areas (in km²) under forests in four countries A, B, C and D for the years 2014 and 2024 are shown in the given bar chart:

The minimum percentage of deforestation during 2014-2024 was in country

1. 1A
2. 2B
3. 3C
4. 4D

A block of marble 5 m × 4 m × 2 m in size is cut into rectangular tiles of 1 m × 0.5 m size having thickness of 10 cm. Assuming 10% wastage in cutting, how many tiles will be made?

1. 1240
2. 2360
3. 3480
4. 4720

What is the remainder when 2023²⁰²⁴ + 2025²⁰²⁴ is divided by 2024?

1. 10
2. 22
3. 3223
4. 42023

If there is rainfall in a village, flowers will bloom. If flowers bloom, celebrations will definitely take place. Flowers did not bloom. Which of the following is certain?

1. 1Celebrations took place
2. 2Celebrations did not take place
3. 3It did not rain
4. 4It rained too much

MAN is to CROWD is as TREE is to ______

1. 1FOREST
2. 2FRUIT
3. 3BRANCH
4. 4ROOT

A man on a cycle is travelling on a terrain whose height (h) vs distance (d) can be described by a function 10d⁴ − 5d² in a certain unit (h can be negative). Starting at d = 0, the cycle will have the maximum velocity without pedaling at:

1. 1d = 1/2
2. 2d = 2
3. 3d = 1
4. 4d = √2

∛0.99 is closest to

1. 10.33
2. 20.14
3. 30.99
4. 40.45

In a box there are 4 white balls and 6 black balls. A ball is drawn at random. If it is white, it is put back along with two more white balls in the box. If it is black, it is put back in the box and then two black balls are thrown out of the box. Now a ball is drawn again at random from the box. Then, what is the probability that it is black?

1. 11/2
2. 21/3
3. 31/4
4. 41/5

If a map is placed in such a manner that east becomes southeast, then what will northeast become?

1. 1North
2. 2East
3. 3West
4. 4South

The sixth largest three-digit odd number among those with all digits distinct is

1. 1989
2. 2987
3. 3973
4. 4971

A fresh water tap fills a fish tank in 40 minutes. The same tank is filled by a salt water tap in 120 minutes. If both the taps are open, how many minutes will it take to fill the tank?

1. 145 minutes
2. 230 minutes
3. 325 minutes
4. 420 minutes

“Amit is a businessman, so he must be rich”. From which of the following statements does the implication follow?

1. 1Only businessmen are rich
2. 2If one is not a businessman, he cannot be rich
3. 3All businessmen are rich
4. 4Some businessmen are rich

An empty plastic mug floats in a bucket of water. When a solid iron ball is kept in the mug it doesn’t sink. When the ball is put in the water it sinks. Compared to when the ball is in water, the water level in the bucket when the ball is in the mug is

1. 1the same
2. 2higher
3. 3lower
4. 4higher or lower depending on the surface area of the ball.

Which one of the following enzymes can unwind short stretches of DNA helix immediately ahead of a replication fork?

1. 1Helicase
2. 2Topoisomerase
3. 3DNA polymerase
4. 4DNA gyrase

Which one of the following is an example of asymmetric cell division in plants?

1. 1Formation of stomatal guard cells from a guard mother cell
2. 2First mitotic division of a microspore
3. 3First mitotic division of a megaspore
4. 4Cell division in the root elongation zone

Which one of the following are NOT glial cells?

1. 1Schwann cells
2. 2Ependymal cells
3. 3Satellite cells of nervous system
4. 4Basket cells

A 16S rRNA gene-based maximum-likelihood tree of soil isolates shows a long branch at the node connecting a clade of Actinobacteria to a clade of Proteobacteria. Which artefact is most likely to be present here?

1. 1Compositional heterogeneity causing long-branch attraction
2. 2Homoplasy in peptidoglycan cross-link pattern
3. 3Inaccurate rooting due to midpoint placement causing long-branch attraction
4. 4Over-parametrization of the GTR+G model

Which one of the following carotenoids is NOT involved in the nonphotochemical quenching of chlorophyll fluorescence in plants?

1. 1Zeaxanthin
2. 2Violaxanthin
3. 3Antheraxanthin
4. 4Canthaxanthin

Steroidogenic acute regulatory protein (StAR) facilitates transfer of cholesterol in which of the following sub-cellular organelles?

1. 1Nucleus
2. 2Golgi bodies
3. 3Mitochondria
4. 4Endoplasmic reticulum

Which one of the following is the correct chronological order of major eras from oldest to youngest?

1. 1Proterozoic → Archean → Phanerozoic
2. 2Archean → Proterozoic → Phanerozoic
3. 3Archean → Phanerozoic → Proterozoic
4. 4Proterozoic → Phanerozoic → Archean

Tomato plants in a subtropical field began to show progressive wilting, interveinal chlorosis, and root rot. The subsequent laboratory analysis indicated coenocytic hyphae along with the presence of thick-walled oospores. Additionally, the disease progressed rapidly in humid conditions. Which one of the following organisms is NOT likely to be responsible for the infection?

1. 1Pythium aphanidermatum
2. 2Phytophthora nicotianae
3. 3Fusarium oxysporum
4. 4Phytophthora infestans

Which one of the following statements about glycosaminoglycans (GAGs) is INCORRECT?

1. 1GAGs are distinguished by their sugars, the type of linkage between the sugars, and the number and location of sulphate groups.
2. 2They are one of the most anionic molecules made by animal cells.
3. 3They are branched polysaccharides, usually made up of repeating units of a sulphated amino sugar and a uronic acid.
4. 4Severe loss of GAGs can lead to premature aging.

In the classical metapopulation model as articulated by Richard Levins (1969, 1970), the metapopulation is considered to be a collection of subpopulations occupying different patches. Which one of the following conditions should be met for a population to be considered as a metapopulation?

1. 1Individual subpopulations should have realistic chances of extinction and recolonization.
2. 2The dynamics of the subpopulations should be dependent on each other.
3. 3Recolonization of a patch after extinction should be mainly through dispersal from the mainland patch.
4. 4Population dynamics in the various patches should be synchronous.

In a study on honey bee foraging, researchers investigated how dopamine release in the mushroom bodies affects the bee’s ability to learn floral odours associated with a nectar reward. Which of Tinbergen’s Four Questions does this study primarily address?

1. 1What is the evolutionary origin of odour-based learning in hymenopterans?
2. 2How does floral odour learning improve foraging efficiency and reproductive success?
3. 3What mechanism underlies the association between floral odour and reward in bees?
4. 4How does floral odour learning change over the lifespan of a honey bee?

The subclasses of terpenes that are generally volatile and often stored in glandular hairs or secretory cavities of leaves and fruits of herb and spice plants are

1. 1monoterpenes and sesquiterpenes
2. 2sesquiterpenes and triterpenes
3. 3diterpenes and triterpenes
4. 4triterpenes and tetraterpenes

A student exposed a plant to a herbicide that blocks electron transport both in Photosystem II and Photosystem I. What is the likely outcome?

1. 1Increased production of NADPH and ATP
2. 2Only ATP would be produced but not NADPH
3. 3Neither ATP nor NADPH would be produced
4. 4The Calvin cycle would operate more efficiently

The Cre-lox system is used to successfully delete a gene specifically in T cells in mice. Which one of the following options is correct?

1. 1Lox P recombination sequences were introduced in tandem at the 5′ end of the gene.
2. 2Lox P recombination sequences were introduced at the 3′ end of the gene.
3. 3Mutant Lox P sites were introduced on either side of the gene and mice were infected with bacteriophage P1 to provide Cre recombinase.
4. 4Mice containing Lox P sites on both 5′ and 3′ ends of the gene were mated with mice that are transgenic for Cre recombinase under control of an inducible promoter.

Which one of the following phytopathogenic bacteria is predominantly transmitted through insects?

1. 1Xanthomonas oryzae
2. 2Ralstonia solanacearum
3. 3Xylella fastidiosa
4. 4Pseudomonas syringae

Ectopic expression of the Vestigial protein in developing eye, antennae and leg discs of Drosophila converts the normal structure into wing tissue. Which one of the following statements is true based on the above information?

1. 1Vestigial expression is essential for wing development.
2. 2Cells in the eye, antennae and leg discs are incompetent for wing tissue specification.
3. 3Vestigial is downstream of the same Hox genes in all developing segments.
4. 4Leg and wing discs originate from distinct embryonic precursors.

Which one of the following features differentiates bacteria from archaea?

1. 1Presence of a cell wall made up of peptidoglycan
2. 2Absence of a nuclear membrane
3. 3Presence of a single circular chromosome
4. 4Presence of multi-cistronic operons

Which one of the following relationships correctly represents the narrow sense heritability? (V_A – additive variance, V_D – dominance variance, V_I – interaction variation, V_GE – genotype × environmental variance, V_T – total variance)

1. 1V_A / V_T
2. 2V_A / V_GE
3. 3V_A + V_D + V_I / V_T
4. 4V_D / V_T

The activation of Cdk2 in vertebrates is dependent on

1. 1dissociation of the inhibitory subunit
2. 2association with cyclin A
3. 3inactivation of CAK
4. 4activity of Wee1 kinase

Two temperature-sensitive mutants of Escherichia coli were mated with each other and none of the resulting exconjugants showed the wild-type phenotype. These mutations are:

1. 1Allelic
2. 2Non-allelic
3. 3Recessive
4. 4Dominant-negative

For a given organism, which one of these life history attributes is associated with the broadest range of environmental tolerance?

1. 1Survival
2. 2Growth
3. 3Reproduction
4. 4Fecundity

Drosophila melanogaster has 4 pairs of chromosomes. There is no recombination in males of this species. What is the number of possible combinations of chromosomes in gametes of males?

1. 1Four
2. 2Eight
3. 3Sixteen
4. 4Thirty-two

A transcript of a gene is shown below, with lines showing introns and rectangles showing exons. A mutation from ‘T’ at the 6^th nucleotide position to ‘A’ in the 1^st exon of the transcript is isolated.

Which one of the following options accurately describes the outcome of this mutation?

1. 1Gain of function
2. 2Loss of function
3. 3No change
4. 4Formation of an altered protein

The levels of which one of the following parameters of blood are measured to check cardiac damage?

1. 1Creatine
2. 2Creatine kinase
3. 3Peroxidase
4. 4Urea

Which of the following features establishes stromatolites as a source of early evidence for life on earth?

1. 1Fossilized bones that have been deeply embedded in a silica-rich matrix
2. 2Layered accretion structures that have been formed as a result of mineral precipitation
3. 3Biogenic laminated structures that have been influenced by phototrophic microbial mats
4. 4Conical limestone mounds that were created by reduced volcanic geothermal activity

Which one of the following does NOT promote aging in humans?

1. 1Increased oxidative stress
2. 2Defects in DNA repair enzymes
3. 3Activation of telomerase
4. 4Reduced biosynthesis of leukotrienes

In the catalytic triad of trypsin protease, serine forms a hydrogen bond with the histidine side chain. What will be the effect of this interaction on the pK_a of the serine side chain?

1. 1The pK_a decreases because the hydrogen bonding with histidine stabilises serine side chain’s protonated state.
2. 2The pK_a increases because the hydrogen bonding with histidine stabilises serine side chain’s deprotonated state.
3. 3The pK_a decreases because the hydrogen bonding with histidine stabilises serine side chain’s deprotonated state.
4. 4The pK_a increases because the hydrogen bonding with histidine stabilises serine side chain’s protonated state.

Which one of the following would be most suitable to study early embryogenesis event using live microscopy of unstained C. elegans embryos?

1. 1Confocal microscope
2. 2Fluorescence microscope
3. 3Differential Interference Contrast microscope
4. 4Super-resolution microscope

Which one of the following statements about human papillomavirus is correct?

1. 1The viral structural protein-encoding genes occasionally integrate into the host genome, leading to cervical cancer.
2. 2The viral protein E7 promotes Rb binding to the E2F, which allows uncontrolled entry into the S Phase of the cell cycle.
3. 3The viral protein E6 binds to p53 and prevents its degradation.
4. 4They infect cervical epithelial cells and maintain themselves in a latent phase as extrachromosomal plasmids.

Which one of the following options best represents cholesterol distribution as a percentage of total membrane lipid in a typical animal cell?

1. 1lysosomal membrane > smooth ER > plasma membrane > inner mitochondrial membrane
2. 2smooth ER > plasma membrane > lysosomal membrane > inner mitochondrial membrane
3. 3plasma membrane > lysosomal membrane > smooth ER > inner mitochondrial membrane
4. 4plasma membrane > inner mitochondrial membrane > smooth ER > lysosomal membrane

The heterotrimeric G-protein signaling component that is uniquely present in the plant lineage is

1. 1GTPase-accelerating protein
2. 2G-protein-coupled receptor
3. 3regulator of G-protein signaling
4. 4extra-large Gα subunit

Why might a plant species evolve cleistogamous flowers in addition to chasmogamous ones?

1. 1To avoid inbreeding depression, a characteristic feature of cleistogamy
2. 2To ensure cross-pollination, a key objective of cleistogamy
3. 3To increase reproductive success in response to uncertainty in pollination
4. 4To enhance the phenomenon of pollinator attraction

If 19% of the nucleotides in a genome are “A”, what percent are “C”, “G”, and “T”?

1. 1C = 31%, G = 31%, and T = 19%
2. 2C = 19%, G = 19%, and T = 31%
3. 3C = 31%, G = 19%, and T = 31%
4. 4C = 19%, G = 31%, and T = 31%

According to the Oparin-Haldane hypothesis, which one of the following statements best describes the Earth’s early atmosphere?

1. 1Rich in oxygen and nitrogen
2. 2Composed primarily of carbon dioxide and oxygen
3. 3Reducing atmosphere with gases such as methane and ammonia
4. 4Similar to the current atmosphere of Earth

Which of the following chemical modifications of uridine residue occur after transcription of tRNA?

1. 1Ribothymidine and pseudouridine
2. 2Ribothymidine and N3-methyluridine
3. 3N3-methyluridine and pseudouridine
4. 4Pseudouridine and N1-Methylpseudouridine

Which one of the following is NOT a microbe-associated molecular pattern (MAMP) of phytopathogens?

1. 1flg22, a 22 amino-acid peptide
2. 2pep13, a 13 amino-acid peptide
3. 3elf26, a 26 amino-acid peptide
4. 4systemin, an 18 amino-acid peptide

Which one of the following datasets (expressed as mean ± SD) is most likely to follow a Gaussian (normal) distribution, considering that the data cannot have any negative values?

1. 1296 ± 190 picomolar concentration of insulin in human blood samples
2. 258 ± 45 number of a particular species of bacteria in the rhizosphere
3. 3160 ± 20 mg/dL of blood cholesterol concentration in human athletes
4. 44 ± 8 number of insects caught in a trap from an agricultural field

Which one of the following habitats harbors the critically endangered Great Indian Bustard (Ardeotis nigriceps)?

1. 1Sal forests of Madhya Pradesh
2. 2Desert grasslands of Rajasthan
3. 3Shola grasslands of southern India
4. 4Terai grasslands of northeastern India

Under the current rules of taxonomy, which one of the following organismal lineages can legitimately receive genus names either under the ICN or under the ICNP, based on the authors’ choice?

1. 1Chlorophyta (Green algae)
2. 2Bacillariophyta (Diatoms)
3. 3Cyanobacteria (Blue-green algae)
4. 4Mycetozoa (Slime moulds)

Which one of the following statements depicts the correct function of TFIIB?

1. 1It binds to the TATA box and helps in the proper positioning of RNA pol II.
2. 2It plays an important role in the elongation phase of transcription.
3. 3It forms the transcription initiation complex by interacting with RNA pol II and TBP.
4. 4It acts as a coactivator that facilitates the binding of enhancers to the promoter.

All of the following are covered by lipid monolayers, EXCEPT

1. 1lipid droplet
2. 2very low-density lipoprotein
3. 3endocytic vesicles
4. 4chylomicrons

Which one of the following proteins is responsible for the permeability of Mg²⁺ through the tight junctions of tubular cells in the thick ascending limb of Henle?

1. 1Claudin – 2
2. 2ZO – 1
3. 3Claudin – 16
4. 4ZO – 3

Which of the following statements indicates the relationship between basal metabolic rate and body size for organisms within a taxonomic group?

1. 1Basal metabolic rate increases linearly with body size
2. 2Weight-specific basal metabolic rate is independent of body size
3. 3Weight-specific basal metabolic rate decreases non-linearly with body size
4. 4Basal metabolic rate increases non-linearly with body size.

The reactions of the urea cycle occur in two different cellular compartments and generate the following intermediates.

1. A. Argininosuccinate
2. B. Citrulline
3. C. Ornithine

Which intermediate(s) must be transported across the mitochondrial inner membrane?

1. 1A and B
2. 2B and C
3. 3A and C
4. 4A only

Which one of the following is the correct arrangement of amino acid dipeptides in increasing order of the area of allowed regions in the Ramachandran map?

1. 1Gly-Gly < Pro-Pro < Ala-Ala ~ Phe-Phe
2. 2Phe-Phe < Ala-Ala < Pro-Pro ~ Gly-Gly
3. 3Pro-Pro < Phe-Phe ~ Ala-Ala < Gly-Gly
4. 4Ala-Ala < Phe-Phe < Gly-Gly < Pro-Pro

Which one of the following biofuels is classified as a first-generation biofuel?

1. 1Cellulosic ethanol
2. 2Bio-ethanol
3. 3Lignin-based biofuels
4. 4Algal biofuels

Ribosomes attach to the endoplasmic reticulum via

1. 1differing surface ribosomal protein composition that allow it to interact with polar headgroups on the ER lipid bilayer.
2. 25′UTR of mRNA being translated that directs the localization of the ribosomes to the ER.
3. 3the translated nascent chain which carries a signal allowing interaction with SRP-receptor on the ER.
4. 4tethered mRNAs that interact with rRNA.

Which one of the following molecules is transported into enterocytes from intestinal lumen by GLUT5?

1. 1Glucose
2. 2Galactose
3. 3Fructose
4. 4Lactose

Mutation of homeotic genes often results in which one of the following developmental defects in Drosophila?

1. 1Polarity defects in every segment along the A-P axis
2. 2Absence of every other segment along the A-P axis
3. 3Transformation of one segment into another
4. 4Absence of a group of contiguous segments

In the circular synteny maps of Poaceae family, providing insights into the origin and evolution of grass genomes, which one of the following genomes should represent the “innermost” circle?

1. 1Arabidopsis thaliana chromosomes (n = 5)
2. 2maize chromosomes (n = 10)
3. 3rice chromosomes (n = 12)
4. 4ancestral chromosomes (n = 12)

An embryo lethal recessive mutation in a plant gene “R” located on chromosome 1 was rescued by an ectopically integrated GFP-tagged wild type “R” transgene (R-comp) which is inserted in chromosome 4. When a female homozygous R-comp plant is crossed to a male purple-coloured recessive mutant, some of the resultant F1 embryos showed chromosome segregation defects. The plants regenerated from these embryos were purple and sterile, and found to contain the wild type gene “R” but not the R-comp transgene. What is the ploidy of the above F1 plants?

1. 1Triploid
2. 2Haploid
3. 3Chromosome 4 trisomy
4. 4Monosomic diploid

Gastric juice (pH 1.5) is produced by pumping HCl from blood plasma (pH 7.4) into the stomach. Calculate the amount of free energy required for H⁺ transport to produce one litre of gastric juice at 37°C. How many moles of ATP must be hydrolyzed to provide this amount of energy? (The free energy change for ATP hydrolysis under cellular conditions is about −58 kJ/mol.) (R = 8.315 J/mol/K)

1. 134 – 36 kJ/mol and 0.6 – 0.61 mol
2. 23.4 – 3.6 kJ/mol and 6.0 – 6.1 mol
3. 322 – 23 kJ/mol and 0.3 – 0.31 mol
4. 417 – 18 kJ/mol and 3.0 – 3.1 mol

Spindle assembly requires the formation of numerous new microtubules. To meet this demand, the spindle contains a large number of regulatory factors. A few protein/protein complexes are mentioned below:

1. A. γ-TuRCs
2. B. Augmin
3. C. TPX2
4. D. Dynein

Which one of the following options includes all the factors that directly impact microtubule nucleation for spindle assembly?

1. 1A only
2. 2A and B only
3. 3A, B, and C only
4. 4A, B, C, and D

The baroreceptors present in the carotid sinus and aortic arch are stretch receptors that provide neural signals to the brain stem for the maintenance of normal blood pressure. The activity of baroreceptors in the regulation of blood pressure and heart rate are proposed in the following statements:

1. A. The increased baroreceptor discharge due to high blood pressure in the carotid sinus and aortic arch stimulates the tonic discharge of sympathetic nerves to blood vessels and heart.
2. B. A decline in the pulse pressure without a change in mean pressure increases the rate of baroreceptor discharge.
3. C. Baroreceptors are more sensitive to pulsatile change of blood pressure than to constant blood pressure.
4. D. The increased baroreceptor discharge excites the vagal innervations to the heart.

Which one of the following options represents all correct statements?

1. 1A, B, C and D
2. 2A, C and D only
3. 3C and D only
4. 4A and B only

The following statements are made regarding vesicle formation, transport, and fusion in cells expressing a mutant Arf protein. This mutant Arf protein is constitutively bound to GTP but is defective for GTP hydrolysis.

1. A. COPI-coated vesicles are only formed from their normal location.
2. B. Arf is constitutively bound to a membrane.
3. C. COPII-coated vesicle fusion with the target membrane is aberrant.
4. D. COPI-coated vesicle fusion with the target membrane is disrupted.

Which one of the following options represents the combination of all correct statements?

1. 1A and B only
2. 2A, B, and D
3. 3B and C only
4. 4B and D only

The operation of the photorespiratory (C₂) pathway involves cooperative interaction among three separate subcellular organelles, namely, chloroplast, mitochondria and peroxisomes. Following are certain statements regarding C₂ pathway:

1. A. 2-phosphoglycolate formed in the chloroplast is converted to glycolate by the action of phosphoglycolate phosphatase.
2. B. Glycolate exits chloroplast by diffusion and enters peroxisome through a glycolate transporter.
3. C. In the peroxisomes, glycolate reacts with O₂ and produces glyoxylate and H₂O₂.
4. D. Only serine:glyoxylate aminotransferase is involved in the conversion of glyoxylate into serine in a peroxisomal reaction.

Which one of the following options correctly marks the above statements as TRUE (T) or FALSE (F)?

1. 1A-T, B-T, C-F, D-T
2. 2A-F, B-T, C-F, D-T
3. 3A-F, B-T, C-T, D-T
4. 4A-T, B-F, C-T, D-F

The following statements are related to airway resistance of lungs in healthy humans:

1. A. The resistance to airflow increases with increasing lung volume.
2. B. The major site of airway resistance is in the first eight generations of airways.
3. C. The smallest airways contribute very little to the overall total resistance of the bronchial tree.
4. D. Breathing a mixture of oxygen-helium instead of oxygen-nitrogen results in a decrease of airway resistance.

Which one of the following options represents all correct statements?

1. 1B and D only
2. 2B, C and D
3. 3A and B only
4. 4A and D only

As per the 2020 FAO Global Forest Resources Assessment, the climatic domains ranked in descending order based on their proportion and distribution of global forest area are:

1. 1Tropical, Subtropical, Temperate, Boreal
2. 2Tropical, Boreal, Temperate, Subtropical
3. 3Boreal, Tropical, Subtropical, Temperate
4. 4Boreal, Temperate, Subtropical, Tropical

Given below is a table listing the names of compounds/products derived from animals or plants (Column X) and their use/application (Column Y).

Which one of the following options represents all correct matches between Column X and Column Y?

1. 1A (iii), B (i), C (ii), D (iv)
2. 2A (ii), B (iii), C (iv), D (i)
3. 3A (i), B (iv), C (iii), D (ii)
4. 4A (iii), B (i), C (iv), D (ii)

The table below lists genes (Column X) and their encoded proteins (Column Y) that play an important role in plant response to biotic stress.

Which one of the following options represents the correct match between Column X and Column Y?

1. 1A-ii, B-i, C-iv, D-iii
2. 2A-iii, B-iv, C-ii, D-i
3. 3A-iv, B-i, C-ii, D-iii
4. 4A-iv, B-ii, C-iii, D-i

The activity of two promoters (A and B) upstream of a luciferase reporter in response to transcription factor TF-X in a cell line was studied. Luciferase activity was measured in cells following overexpression and RNAi silencing of TF-X and compared to control (Native TF-X level). The luciferase enzyme activity is tabulated below.

Based on the above table, following statements were made

1. A. TF-X is needed for basal activity of promoter A.
2. B. TF-X is needed for basal activity of promoter B.
3. C. TF-X functions both as a positive and negative regulator for promoter A.

Which one of the following options represents correct statement(s)?

1. 1A only
2. 2B only
3. 3A and B
4. 4A and C

A network of genes regulates vertebrate eye development. The loss or gain of function of select genes are listed in Column X, and their effects or phenotypes are listed in Column Y.

Which one of the following options represents all correct matches between column X and column Y?

1. 1A – iv, B – i, C – ii, D – iii
2. 2A – ii, B – iii, C – i, D – iv
3. 3A – iii, B – ii, C – iv, D – i
4. 4A – iv, B – ii, C – i, D – iii

The Red List of the IUCN categorises species (Column X) under multiple threat levels (Column Y). Match the following species with their IUCN status (as of the latest reports):

1. 1A-(i), B-(iv), C-(ii), D-(iii)
2. 2A-(iv), B-(i), C-(ii), D-(iii)
3. 3A-(iv), B-(ii), C-(i), D-(iii)
4. 4A-(i), B-(iv), C-(i), D-(ii)

Sucrose transport in plant cells follows both active transport and diffusion mechanisms. The given figure shows the rate of sucrose uptake by soybean protoplasts as a function of the external sucrose concentrations.

Based on the given information, a researcher made following interpretations:

1. A. Sucrose uptake at low concentration (<10 mM) is facilitated by an energy-dependent process.
2. B. Sucrose uptake at low concentrations is a carrier-independent process.
3. C. At higher concentrations, sucrose enters the cells by diffusion down its concentration gradient.
4. D. Inhibition of ATP synthesis with metabolic poison can block only the linear component.

Which one of the following options represents the combination of all correct interpretations?

1. 1A and B
2. 2B and C
3. 3A and C
4. 4C and D

In a dioecious plant species, a single gene is responsible for petal colour. A cross between a true breeding red female and a true breeding white male gave rise to all red male and all white female F1 progeny. However, the reciprocal cross produced all red males and all red females.

Which one of the following explains the inheritance of petal colour?

1. 1The gene is located in the mitochondrial genome.
2. 2Males are homogametic; gene is located on the sex chromosome.
3. 3Females are homogametic; gene is located on the sex chromosome.
4. 4The gene is located on an autosome.

A population of Indian wolf shows logistic growth. Let the carrying capacity (K) be 200 and intrinsic rate of increase, r = 0.05. What is the maximum possible growth rate for the population (in terms of individuals per time unit)?

1. 12.0
2. 22.5
3. 33.5
4. 45.0

Equal numbers of particles of a mutant viral strain ‘A’ and the wild-type strain (WT) were used to separately infect equal numbers of synchronized compatible host mammalian cells. RNA from host mammalian cells were subjected to real-time quantitative PCR to analyze levels of the viral gag gene and host beta-tubulin after 24 hrs. C_t values for the above measurements are listed below.

By how much have the gag transcripts in ‘A’-infected cells changed with respect to ‘WT’-infected cells?

1. 1Reduced to 1/32 of WT
2. 2Reduced to 1/4 of WT
3. 3Reduced to 1/2 of WT
4. 4No change

Given below is the list of molecules that target the nervous system (Column X) and their modes of action (Column Y).

Which one of the following options represents the correct matches between Column X and Column Y?

1. 1A-ii; B-i; C-ii; D-iv
2. 2A-iv; B-ii; C-iii; D-i
3. 3A-iii; B-iv; C-i; D-ii
4. 4A-iii; B-i; C-iv; D-ii

Given below are a few biological lipids (Column X) and their chemical nature (Column Y).

Which one of the following options correctly matches the lipid to its chemical nature?

1. 1a:v; b:iv; c:i; d:iii; e:ii
2. 2a:v; b:i; c:iii; d:ii; e:iv
3. 3a:iv; b:v; c:iii; d:ii; e:i
4. 4a:iv; b:iii; c:ii; d:i; e:v

A novel DNA-binding protein (P) was tested for its mode of binding with DNA (D), for which a DNase I assay was performed. P was incubated with DNA to form a P-D complex, to which DNase I was added. Assume constant concentration of P, D, and DNase I. The reaction was terminated at increasing time-points (minutes) and resolved on a sequencing-grade polyacrylamide gel.

Based on the results of the DNase I digest, which one of the following options is the correct interpretation?

1. 1P does not bind to D, thereby generating a banding pattern of D.
2. 2P binds to D at a specific site, generating a banding pattern of D.
3. 3P binds and exposes multiple sites on D, generating a banding pattern of D.
4. 4P binds to only the 5′ and 3′ ends of D, generating a banding pattern of D.

The following statements are made about transgenic mice technologies:

1. A. Catalytically inactive Cas9 fused to a transcription activator can be used to activate specific gene expression.
2. B. Using CRISPR/Cas9, a precise gene replacement in a target locus can be accomplished by non-homologous end joining repair.
3. C. Using CRISPR/Cas9, many genes can be targeted at once by expressing many guide RNAs in the same cell.
4. D. All chimeric mice derived by injecting engineered mouse embryonic stem cells into blastocysts will carry the transgene in the germ line.
5. E. In the Cre-lox conditional system, the Cre recombinase is inserted into the gene to be knocked out.

Which one of the following options represents the combination of all correct statements?

1. 1A, C, and E
2. 2A and C only
3. 3B, D, and E
4. 4B and D only

The figure below is a schematic representation of the replication fork. The different proteins associated with DNA replication are marked by A, B, C, D, E, and F.

Which one of the following options correctly represents the names of these proteins?

1. 1A: DNA Helicase; B: DNA Gyrase; C: DNA Primase; D: DNA pol III; E: DNA pol I; F: DNA Ligase
2. 2A: DNA Gyrase; B: DNA Helicase; C: DNA Primase; D: DNA pol II; E: DNA pol I; F: DNA Ligase
3. 3A: DNA Helicase; B: DNA Gyrase; C: DNA Primase; D: DNA pol III; E: DNA pol II; F: DNA Ligase
4. 4A: DNA Gyrase; B: DNA Helicase; C: DNA Primase; D: DNA pol II; E: DNA pol III; F: DNA Ligase

Panel (I) represents two alleles of a gene. The coding region of the wild type allele (R) is 3 Kb long while the mutant allele (r) has a 0.5 Kb insertion. The black box indicates insertion in the r allele. Three primers indicated as X, Y and Z were designed to develop PCR based DNA markers associated with the gene.

A cross was carried out between lines with the genotypes RR and rr. The F₁ progeny was selfed. Panel (II) and (III) represent the probable patterns of DNA markers observed in the F₂ progeny using different primer combinations.

Which one of the following statements is correct?

1. 1Panel III represents the pattern when primers Y and Z are used for amplification.
2. 2Panel II is an example of a dominant DNA marker.
3. 3The F₂ progeny as represented in Panel II, will have 50% of the progeny showing no amplified fragment (lane 1).
4. 4A rare recombination event between the regions represented by primers X and Y will lead to changes in the amplification patterns observed in Panels II and III.

Shown below is a Northern blot profile with five independent probes representing the transcript from a single genetic locus.

Based on the Northern blots, which of the diagrams below best represents the order of genes encoded in the genetic locus? Note: Exon and intron junctions are given only for the transcript from TSS1. For options 2, 3 & 4, the mature transcript from TSS2 retains the intron.

1. 1
2. 2
3. 3
4. 4

A glucose biosensor exhibits Michaelis-Menten kinetics with a maximum current response, Imax = 250 μA, and a Michaelis constant, Km = 5.2 mM. If the glucose concentration in a sample is 3.4 mM, what is the current response (I) of the biosensor?

1. 198.83 μA
2. 2250 μA
3. 329.06 μA
4. 473.52 μA

The following statements are made about body temperature regulation in humans:

1. A. As the skin temperature falls, the hypothalamic set point for sweating decreases.
2. B. Acclimatization to cold activates the uncoupling protein (UCP) in mitochondria.
3. C. Acclimatization to heat decreases aldosterone secretion.
4. D. Sodium ion concentration in sweat decreases upon acclimatization to heat.
5. E. When the body temperature becomes high, the skin blood vessels undergo vasodilation.

Which one of the following options represents the combination of all correct statements?

1. 1A, B, and C
2. 2B, D, and E
3. 3B and C only
4. 4A, D, and E

The ability to unwind RNA substrates I and II by translation regulator ‘X’ was studied. RNA substrates with radiolabeled antisense strand (*) were incubated with purified ‘X’ under the conditions listed below. Subsequently, RNA species were separated by polyacrylamide gel electrophoresis (PAGE), followed by autoradiography. The results are shown below:

The following statements are made purely based on the observed gel patterns:

1. A. X unwinds substrates with a 5′ overhang.
2. B. Substrates which can be unwound by ‘X’ need ATP for efficient RNA unwinding.
3. C. X unwinding activity is enhanced by the presence of eIF4G.

Which one of the following options represents the combination of all correct statements?

1. 1A and B only
2. 2B and C only
3. 3A and C only
4. 4A, B and C

Which one of the following statements best describes the function of magnetite in animal migration?

1. 1Magnetite crystals generate electrical signals that amplify visual landmarks that guide flight.
2. 2Magnetite acts as a biological compass.
3. 3Magnetite stores magnetic energy that provides energy for long-distance flights.
4. 4Magnetite emits magnetic pulses to keep the group together.

Lab-grown cells of a tumor (Wild type) expressing a novel cancer antigen, and a variant of the same tumor that has lost MHC class I expression, were injected subcutaneously into normal mice (dotted line) and into nude mice (solid line). The growth of the tumors in the two mouse strains is shown below.

The following statements were made based on the results observed:

1. A. In normal mice, CTLs recognize tumor cells in the presence, but not absence, of MHC-I.
2. B. In nude mice, NK cells recognize tumor cells in the absence, but not in the presence, of MHC-I.
3. C. CTLs and NK cells inhibit each other if MHC-I is present, but not if it is absent.
4. D. In mice injected with tumors lacking MHC-I, antibodies generated with the help of CD4 cells restrain the growth of the tumor in nude mice.

Which one of the following options represents the combination of all correct statements?

1. 1A and D
2. 2B and C
3. 3A and B
4. 4A only

Eukaryotes regulate gene expression via histone modifications. In the table given below, the histone modification (column X), its association with chromatin type (column Y), and their impact on gene expression (column Z) is listed.

Which one of the following options correctly matches all terms in the most appropriate combination?

1. 1(A)-(a)-(i); (B)-(c)-(ii); (C)-(a)-(i); (D)-(b)-(ii)
2. 2(A)-(b)-(i); (B)-(b)-(ii); (C)-(c)-(i); (D)-(a)-(ii)
3. 3(A)-(c)-(ii); (B)-(a)-(i); (C)-(a)-(i); (D)-(c)-(ii)
4. 4(A)-(c)-(i); (B)-(a)-(ii); (C)-(a)-(ii); (D)-(b)-(i)

Given below are statements about the action of glucagon in human body:

1. A. It does not cause glycogenolysis in muscle.
2. B. It decreases ketone bodies formation in the liver.
3. C. It does not cause lipolysis in the liver.
4. D. It inhibits conversion of phosphoenolpyruvate to pyruvate in the liver.

Which one of the following options represents both correct statements?

1. 1A and B
2. 2B and C
3. 3C and D
4. 4A and D

Interactions among ‘maternal effect gene’ and ‘gap gene’ products are crucial for establishing embryonic domains in the Drosophila embryo. Which one of the following options DOES NOT show the correct interactions?

1. 1Diagram 1
2. 2Diagram 2
3. 3Diagram 3
4. 4Diagram 4

Lettuce seed germination is a typical photo-reversible response controlled by phytochrome. Seeds in a petridish were exposed to Red light (R), Far-Red light (FR) or kept in the dark (black bar) according to the schedule in Column X. The effect on seed germination is provided in Column Y.

Which one of the following combinations represents the correct match between Column X and Column Y?

1. 1A-i, B-ii, C-i, D-ii, E-i
2. 2A-i, B-i, C-i, D-i, E-ii
3. 3A-ii, B-ii, C-ii, D-ii, E-i
4. 4A-ii, B-i, C-ii, D-i, E-ii

Proteins possess a sorting signal known as a nuclear localization signal (NLS) for their import into the nucleus. A few statements are given below on the import of proteins destined for the nucleus.

1. A. The import receptor binds to the nuclear localization signal.
2. B. The import receptor contains several low-affinity binding sites for the nucleoporins.
3. C. The nuclear import receptor-cargo complex is dissociated by RanGDP in the nucleus.
4. D. The nuclear import receptor-cargo complex binds to RanGTP in the cytosol and traverses the nuclear envelope.

Which one of the following options has all the correct statements about nuclear protein import?

1. 1A only
2. 2A and B
3. 3B and C
4. 4C and D

The following statements are made regarding leaf development in plants:

1. A. The activity of KNOX1 and ARP are mutually repressive to help establish a separate identity for emerging leaf primordium.
2. B. PHANTASTICA is required for adaxial cell fate during leaf development.
3. C. KANADI genes promote abaxial cell fate during leaf development.
4. D. miR166 binds to KANADI mRNA and degrades it on the abaxial side of the leaf primordium.
5. E. Overexpression of KNOX1 increases leaf complexity and indeterminacy.

Which one of the following options represents all correct statements?

1. 1A, B, C and E
2. 2A, C, D and E
3. 3A, B, C, and D
4. 4A, B, D and E

Different segments of the renal tubule (Column X) and the sodium transporter in the apical membrane of tubular cells (Column Y) are given below:

Which one of the following options represents the correct match between Column X and Column Y?

1. 1a – iv, b – i, c – ii, d – iii
2. 2a – ii, b – iv, c – i, d – iii
3. 3a – i, b – ii, c – iii, d – iv
4. 4a – iii, b – iv, c – i, d – ii

The Satpura Hypothesis suggests that the Satpura Range in central India acted as a bridge for the migration of Malayan taxa into peninsular India. However, empirical observations do not fully support this hypothesis. Consider the following statements made in the context of biogeographic patterns.

1. A. The shared characteristics of some Malayan fauna and that of peninsular India is due to convergent evolution in similar environments.
2. B. The said flora and fauna originated in the Indian subcontinent and then dispersed to south-east Asia (‘out-of-India’).
3. C. Vicariance biogeography split ancestral populations, leading to the diversification of species.
4. D. Pleistocene glaciation created conditions for the dispersal of high-altitude Himalayan taxa to the Western Ghats.

Which combination of the above statements have been proposed as alternative explanations for the Satpura hypothesis?

1. 1A, B and C
2. 2A, B and D
3. 3A and B only
4. 4B, C and D

Izumo and Juno are two proteins that are expressed in sperm and egg, respectively and play critical roles in mediating interactions between them. The following experiments were carried out with Izumo and Juno:

1. A. Sperms from a male mouse, where Izumo has been knocked out, could not fertilize eggs from a normal female.
2. B. Two independent kidney cell lines were developed, one expressing Izumo and the other expressing Juno. If the two cells are mixed, the cells will tend to aggregate with each other.
3. C. Whole mount immunostaining for Izumo and Juno indicated specific staining on the sperm and egg, respectively.

Which one of the following options lists experiment(s) that demonstrate(s) interactions between Izumo and Juno?

1. 1A only
2. 2B only
3. 3A and C
4. 4C only

A canonical Watson-Crick G:C base pair is stabilized by three hydrogen bonds formed between a donor (+0.25e) and acceptor (−0.35e) atom located at a distance r = 2.9 Å. Assume that the dielectric constant ‘D’ in the DNA core is 4, and in water is 78.5. Which one of the following options correctly represents the total difference in electrostatic interaction energy for all 3 hydrogen bonds when buried in the DNA core versus fully exposed to solvent?

(Modified Coulomb’s constant, k = 1389 kJ/mol·nm·e⁻²)

1. 1−298.3 kJ/mol
2. 2−104.7 kJ/mol
3. 3−99.4 kJ/mol
4. 4−5.338 kJ/mol

Male crickets call at dusk when the light intensity falls below a certain level. A researcher kept these insects in the laboratory under two light regimes: i) constant light condition for 24 hours (LL) and ii) 12 hours Light and 12 hours Dark cycle (LD). The calling activity pattern of the crickets in these two regimes across all experimental days is represented in the figure below.

The statements below represent inferences that one can draw about circadian control of calling activity in these animals.

1. A. Calling activity under LL represents free-running cycle and LD represents entrained cycle.
2. B. Calling activity under LL represents entrained cycle and LD represents free-running cycle.
3. C. The circadian control of calling activity is endogenous only.
4. D. The circadian control of calling activity is exogenous only.
5. E. The circadian control of calling activity has both endogenous and exogenous components.

Which one of the following options gives all correct statements about the inferences we can draw from this experiment?

1. 1A and C
2. 2B and C
3. 3B and D
4. 4A and E

Given below are a few statements related to genetics and linkage mapping in plants.

1. A. Near Isogenic Lines are immortal populations.
2. B. The physical distance between two polymorphic markers is not linearly related to their genetic distance.
3. C. QTLs identified for a particular phenotype or trait of interest always contribute equally to the trait value.
4. D. Association mapping is performed using unrelated individuals of the same population.

Which one of the following options correctly describes the above statements as “True” or “False”?

1. 1A: True; B: False; C: True; D: False
2. 2A: False; B: True; C: False; D: False
3. 3A: True; B: True; C: False; D: True
4. 4A: False; B: False; C: True; D: True

Two samples were run on a flow cytometer and the data were plotted as histograms A and B, as shown below.

The following statements were made:

1. A. Figure A represents three normal distributions with more variation within groups than between groups.
2. B. Figure B represents three normal distributions with more variation between groups than within groups.
3. C. The ANOVA-F test is likely to be statistically significant when applied to Figure B, but not to Figure A.

Which one of the following options represents the combination of all correct statements?

1. 1A only
2. 2A and B only
3. 3B and C only
4. 4A, B and C

In a successional chronosequence (30 – 400 years) on a sand dune, Ammophilia dune grass dominates the youngest dunes, the prairie bunch grass Schizachrium dominates at 60 years, followed by Pinus species at later stages. Experimental seed additions were done to study seedling emergence (as a proportion of viable seeds) of all species on all the dunes (Panel 1). In addition, the effect of seed predation on seedling emergence (across dune ages) was also tested (Panel 2). The following figure presents results on seedling emergence.

Based on the above, consider the following statements regarding the possible interpretation of the results.

1. A. Late successional species can establish on younger dunes but may be limited by seed dispersal.
2. B. Seed predation reduces the establishment of late successional species on younger dunes.
3. C. Facilitation has stronger influence than colonization or seed predation on successional change.
4. D. Late successional species cannot establish on younger dunes because of the sandy substrate.

Which combination of the above statements represents valid inference that can be drawn purely from the data presented above?

1. 1A and B only
2. 2A, B and C
3. 3B, C and D
4. 4B and C only

The following figure shows the decomposition of selected plant litter constituents.

In the above, the correct identities of the symbols A, B, C and D are:

1. 1A-Lignin, B-Phenols, C-Sugars, D-Cellulose
2. 2A-Phenols, B-Lignin, C-Cellulose, D-Sugars
3. 3A-Cellulose, B-Lignin, C-Sugars, D-Phenols
4. 4A-Cellulose, B-Phenols, C-Lignin, D-Sugars

Match the animal phyla/classes (Column X) with their defining set of characteristics (Column Y).

1. 1A-iii, B-iv, C-v, D-ii
2. 2A-i, B-iv, C-v, D-ii
3. 3A-iii, B-i, C-v, D-iv
4. 4A-v, B-ii, C-iii, D-i

Given below are certain plant diseases and the pathogens responsible.

Which one of the following options correctly matches the disease with its pathogen?

1. 1A-(iv), B-(iii), C-(i), D-(ii)
2. 2A-(ii), B-(i), C-(iv), D-(i)
3. 3A-(ii), B-(iii), C-(ii), D-(i)
4. 4A-(iii), B-(iii), C-(i), D-(iv)

Human prostate cancer cells expressing urokinase Plasminogen Activator (uPA) readily metastasize when injected into experimental animals. A scientist genetically modified prostate cancer cells and injected them into experimental animals. The possible observations are listed below:

1. A. Overexpressing a mutant version of the uPA protein that does not bind to its receptor led to tumour formation but reduced metastasis.
2. B. Overexpressing a mutant version of the uPA protein that does not bind to its receptor led to enhanced tumour formation as well as metastasis.
3. C. Overexpressing a secreted version of the uPA receptor led to tumour formation but reduced metastasis.
4. D. Overexpressing a secreted version of the uPA receptor reduced tumour formation as well as metastasis.

Which of the following options represents the combination of all correct observations?

1. 1A and C
2. 2B and D
3. 3A and D
4. 4B and C

Which one of the following matrices represents the correct choice regarding the two types of errors made in statistical hypothesis testing? H₀ = Null hypothesis.

Choose the correct option.

1. 1B
2. 2A
3. 3D
4. 4C

A transformation experiment is performed with two Pneumococcal strains. One strain is resistant to four drugs – A, B, C, and D, whereas the other is sensitive to all the drugs. Both strains are mixed and the mixture is plated on media containing various combinations of the drugs. The colonies obtained on these plates are given below:

Based on the above results, which one of the below options represents the most likely order of the drug-resistance genes?

1. 1A-B-C-D
2. 2A-C-B-D
3. 3A-D-C-B
4. 4A-D-B-C

The below pedigree shows the inheritance pattern of gene X. A loss of function mutation of the gene leads to a disorder in adults. Further, gene X is imprinted leading to its inactivation. Individuals who carry the mutant allele are marked with a dot, while individuals who show the disorder are shaded.

The following statements were made:

1. A. Gene X is maternally imprinted.
2. B. Individual III.6 carries an imprinted allele.
3. C. If individuals III.4 and III.5 have a child, the probability that it will carry at least one mutant allele is 0.75.
4. D. If individuals III.4 and III.5 have a child, the probability that it will show the disorder is 0.75.

Which one of the following options represents all correct statements?

1. 1A and C
2. 2A and D
3. 3B and C
4. 4B and D

The table below presents the energy transfer values for various activities exhibited by three herbivores inhabiting a grassland with a net primary productivity (NPP) of 10000 kJ/m²/year.

Based on the information provided, which one of the following options is NOT correct?

1. 1C has the highest consumption efficiency but the lowest assimilation efficiency.
2. 2B has the highest consumption efficiency, but C has the highest assimilation efficiency.
3. 3A and B have the highest assimilation efficiencies.
4. 4A has the lowest consumption efficiency.

Given below are names of techniques (Column X) and their characteristic features measured for molecular characterization (Column Y).

Which one of the following options represents all correct matches between Column X and Column Y?

1. 1A (iii), B (v), C (iv), D (vi), E (vii)
2. 2A (ii), B (iii), C (i), D (vii), E (vii)
3. 3A (v), B (iv), C (iii), D (ii), E (i)
4. 4A (iii), B (i), C (ii), D (vi), E (iv)

The following statements are made about the subcellular localization of steroid synthesizing enzymes in adrenal cortical cells.

1. A. 3β-Hydroxysteroid dehydrogenase is present in mitochondria.
2. B. 17α-Hydroxylase is present in the smooth endoplasmic reticulum.
3. C. 11β-Hydroxylase is present in mitochondria.
4. D. 21β-Hydroxylase is present in smooth endoplasmic reticulum.

Which one of the following options represents both correct statements?

1. 1A and B
2. 2B and C
3. 3C and D
4. 4A and D

Which one of the following options correctly represents mass extinction events in increasing order of percentage loss of species?

1. 1Triassic, Devonian, Ordovician, Permian
2. 2Permian, Triassic, Devonian, Ordovician
3. 3Devonian, Triassic, Ordovician, Permian
4. 4Permian, Ordovician, Triassic, Devonian

In early amphibian development, the ectodermal cells with BMP4 activity leads to epidermal ectoderm fate. If cells lack BMP4 activity, they take up a fate of neural ectoderm. BMP inhibitors like noggin dorsalize the ectodermal cells and give rise to neural ectoderm.

The following statements are made with reference to the above:

1. A. The default fate of the ectoderm is to become neural tissue.
2. B. Noggin mRNA will be depleted in lithium chloride treated gastrula.
3. C. Injection of noggin mRNA into UV-radiated embryos at 1-cell stage rescued dorsal development.

Which one of the following options represents a combination of all correct statements?

1. 1A only
2. 2B only
3. 3A and C
4. 4B and C

The table below lists insect sensory structures (Column X) with their function (Column Y).

Which one of the following options correctly matches column X and column Y?

1. 1A-iii, B-iv, C-i, D-ii
2. 2A-i, B-iii, C-ii, D-iv
3. 3A-iv, B-ii, C-iii, D-i
4. 4A-ii, B-i, C-iv, D-iii

Given below are four niche-oriented models proposed to explain species-abundance distributions in ecological communities.

1. A. The dominance-preemption model involves successive species preempting a dominant portion (50% or more) of the remaining niche-space.
2. B. In the random fraction model, successive species invade and take over an arbitrary portion of the niche space of any species previously present. Here, irrespective of their dominance status, all species are subjected to niche division with equal probability.
3. C. The MacArthur fraction model assumes that larger niches are more likely to be invaded by new species.
4. D. The dominance-decay model postulates that the largest niche in an existing assemblage is always subject to a subsequent (random) division.

Assuming a process of community assembly that involves successive species invading and establishing in the community, what would be the correct order of evenness in community structure produced by these mechanisms?

1. 1A > B > C > D
2. 2A < B < C < D
3. 3B > C > D > A
4. 4D > B > A > C

A polymerase chain reaction (PCR) with all necessary reagents was carried out to amplify a 200 bp target region of a human Y chromosome. PCR was started with 100 copies of double stranded DNA (ds DNA) as template.

Assuming 100% PCR efficiency, how many copies of the desired 200bp fragment consisting of ONLY the target region would be produced at the end of the third PCR cycle?

1. 1100
2. 2200
3. 31000000
4. 40

Given below are thermal melting curves for proteins A, P, Q and R. The X-axis denotes temperature, while the Y-axis indicates the concentration of unfolded protein.

Which one of the following options is true regarding comparative thermostability of protein A with respect to P, Q and R?

1. 1A < P; A > Q; A > R
2. 2A < P; A > Q; A = R
3. 3A ~ P; A < Q; A < R
4. 4A ~ P; A < Q; A > R

A child injures his toe, which then becomes infected with Staphylococcus aureus. The following statements are made about the events that follow over the course of a week:

1. A. The pathogen is conveyed to draining lymph nodes by macrophages.
2. B. Danger signals are conveyed to high endothelial venules of draining lymph nodes through the fibroblastic reticular conduit system.
3. C. Naïve B cells and T cells enter draining lymph nodes from high endothelial venules by a process that is initiated by ICAM-1-mediated rolling.
4. D. Naïve B cells exit circulation at the site of injury and undergo clonal expansion in response to bacterial LPS.

Which one of the following options represents the combination of all correct statements?

1. 1A and B only
2. 2A and C only
3. 3B and D only
4. 4A, C and D

Shown below is a hypothetical metabolic pathway leading to the production of lignin metabolite, and the three pathway enzymes (X, Y and Z), of which Z is regulated by feedback inhibition.

Which one of the following strategies will lead to the generation of plants with the highest level of lignin?

1. 1Overexpression of the genes expressing enzyme X.
2. 2Knockout of the gene expressing enzyme Y.
3. 3Overexpression of the genes expressing enzymes X and Z.
4. 4Overexpression of gene expressing enzyme X and knockout of gene expressing enzyme Y.

The table below describes the effect of various antibiotics on protein translation in bacteria.

Which one of the following options represents all correct matches between Column X and Column Y?

1. 1A – (i), B – (ii), C – (iii), D – (iv)
2. 2A – (i), B – (iii), C – (ii), D – (iv)
3. 3A – (iii), B – (i), C – (ii), D – (iv)
4. 4A – (ii), B – (iii), C – (iv), D – (i)

Caterpillars produce defensive vibrations that travel through plant stems to deter its predators. The table below summarises data collected from three plant species, including vibration amplitude measured 10 cm from the caterpillar, predator response time, and the Young’s modulus of the stem.

Choose the option that correctly provides a mechanistic explanation for the data presented in the above table.

1. 1A is a herbaceous plant and its stem dissipates energy faster compared to B and C which are woody plants.
2. 2C is a woody plant, and predators detect vibrations on it more easily compared to A and B which are herbaceous plants.
3. 3Predators are more inefficient on herbaceous plant species A and B, and more efficient on woody plant species C.
4. 4C is an herbaceous plant and its stem is more likely to transmit vibrations more effectively when compared to plant species A and B which are woody.

An alpha helix formed by 30 residues is stabilized by 25 backbone hydrogen bonds in its folded state. Assume that the average energy of a hydrogen bond is ~10 kJ/mol, and the disruption in the peptide resonance causes a partial loss of 205 kJ/mol per peptide bond. Assume that the folding and unfolding process only changes peptide resonance stabilization partially and the loss of hydrogen bonding upon unfolding (ignore side-chain interactions and entropy losses). Which one of the following options represents the correct magnitude of the net energetic difference between the folded and unfolded state of the helix?

1. 16195 kJ/mol
2. 25945 kJ/mol
3. 3250 kJ/mol
4. 45695 kJ/mol

The following statements are related to different signaling pathways involved in tetrapod limb development.

1. A. Shh released by the ZPA inhibits Fgf8 signaling in the AER.
2. B. FGFs released by the AER activate Shh expression in the ZPA.
3. C. Wnt7a expression in the dorsal ectoderm plays a role in limiting Shh expression in the ZPA.
4. D. Overactivation of Wnt signaling in the ventral ectoderm causes an overgrowth of AER and formation of extra digits.

Which one of the following options represent all correct statements?

1. 1A, B, and C
2. 2A and D only
3. 3B and D only
4. 4B, C, and D

A 19^th century phycologist described a soil dwelling cyanobacterium Nostoc arcus and cited three herbarium sheets (X, Y and Z) collected from different deserts, but no holotype was designated in that work. In 2024, a taxonomist intended to stabilize the name and hence selected sheet Z as the reference specimen due to the better morphological clarity and preservation of the sample.

What nomenclatural task is the taxonomist performing under the ICN?

1. 1Designating a neotype because the original material was not sufficient.
2. 2Designating a holotype because the best specimen is being chosen.
3. 3Designating a lectotype because the original material consisted of syntypes.
4. 4Designating an epitype because morphological details are clear.

Following are a few statements regarding mapping populations and principles of genetic mapping in crop species.

1. A. For self-pollinating species, both F2 and F1-derived doubled haploids can serve as mapping populations.
2. B. For cross-pollinating species, F1 population can be used for mapping studies.
3. C. Bulk segregant analysis (BSA) is often used to identify linked markers for complex traits with multiple genes and environmental influences.
4. D. In crop plants, sets of different breeding lines can be exploited for trait mapping.
5. E. Breeding methods such as single-seed descent and pedigree selection promote genetic variability.

Which one of the following options represents the combination of all INCORRECT statements?

1. 1A, B and C
2. 2B, C and D
3. 3C, D and E
4. 4C and E only

The Hawk-Dove game serves as a model for conflict resolution in evolutionary game theory, wherein players 1 and 2 have the option of employing either an aggressive (Hawk) or a peaceful (Dove) strategy. The diverse interaction scenarios and their corresponding payoffs (P, Q, R, S) are presented in the following matrix:

If V = the value of the resource (the benefit), C = the cost of losing a fight in the above matrix, which one of the following options correctly represents the payoffs?

1. 1P = V, Q = 0, R = (V/2), S = (V−C)/2
2. 2P = (V−C)/2, Q = V, R = 0, S = (V/2)
3. 3P = V, Q = 0, R = (V−C)/2, S = (V/2)
4. 4P = (V/2), Q = (V−C)/2, R = V, S = 0

If 10 μg of pure carbonic anhydrase catalyzes the hydration of 0.30 g of CO₂ in 1 min at 37°C at V_max, what is the turnover number (k_cat) of carbonic anhydrase (in units of min⁻¹)? (M_r of carbonic anhydrase is 30,000)

1. 13.2 × 10³ min⁻¹ to 3.3 × 10³ min⁻¹
2. 22.0 × 10⁷ min⁻¹ to 2.1 × 10⁷ min⁻¹
3. 30.30 × 10⁷ min⁻¹ to 0.31 × 10⁷ min⁻¹
4. 42.0 × 10³ min⁻¹ to 2.1 × 10³ min⁻¹

The following statements are made regarding TAL effectors that play an important role during bacterial pathogenesis in plants.

1. A. They are bacterial proteins that are translocated into the host plant cells using the type IV secretion system.
2. B. They harbour a central DNA-binding region comprising a tandem array of nearly identical repeats.
3. C. They can act as both virulence factors as well as avirulence factors.
4. D. They are only restricted to members of the Xanthomonas species that infect rice.

Which one of the following options represents the combination of all correct statements?

1. 1A and B
2. 2B and C
3. 3C and D
4. 4A and D

Shown in the table are some cultivated crops (Column X) and the chromosomal ploidy (Column Y).

Which one of the following options represents all correct matches between Column X and Column Y?

1. 1A (v), B (ii), C (iii), D (i), E (iv)
2. 2A (ii), B (iv), C (i), D (iii), E (v)
3. 3A (v), B (iii), C (i), D (iv), E (ii)
4. 4A (ii), B (iv), C (iii), D (i), E (v)

Human lymphocytes were incubated with increasing concentrations of NaCl. Which one of the following options represents the correct response of the nucleus and the chromatin to increase in salt concentrations?

1. 1The nucleus bursts at low NaCl concentrations, liberating the chromatin into the cytosol.
2. 2At higher salt concentration the heterochromatin gets converted into euchromatin and comes out of the nucleus.
3. 3The nucleus does not burst but the heterochromatin leaches out first.
4. 4The nucleus does not burst but the euchromatin leaches out first.

A researcher simultaneously disrupted the activities of “Ferrochelatase” and “Chlorophyllide a oxygenase” enzymes involved in the biosynthesis of heme and chlorophyll, respectively in Arabidopsis. The researcher made the following predictions about the outcomes of the above experiments.

1. A. The synthesis of “Chlorophyll a” from “Chlorophyllide a” will be inhibited.
2. B. The synthesis of “Chlorophyll b” will be completely inhibited.
3. C. The content of “Heme” molecule will be higher compared to wild-type plants.
4. D. The metabolic flux will shift towards the biosynthesis of “Chlorophyll a”.

Which one of the following options represents the combination of all correct outcomes?

1. 1A and B
2. 2B and C
3. 3C and D
4. 4B and D

The primary sequence of a miRNA is given below.

5′ – UAGCUUAUCAGACUGAUGUUGA – 3′

The seed region of miRNA starts from the 2^nd position to the 8^th position. Which one of the following mRNA sequences would be targeted by the above miRNA?

1. 15′ – CUCGAGGCAACAUCAGUCUGAUAAGCUAGAGCUC – 3′
2. 25′ – CUCGAGUAGCUUAUUAGACUAAUGUUGAGAGCUC – 3′
3. 35′ – CUCGAGAUUUGGUAUGCGCGAAUACCAAUCUCGA – 3′
4. 45′ – CUCGAGGAGAUUGGUAUUCGCGCAUACCAAAUCU – 3′

Following statements are made regarding the biosynthesis of phytohormones.

1. A. Indole-3-butyric acid is converted to IAA by β-oxidation in peroxisomes.
2. B. The gibberellin precursor, geranyl geranyl diphosphate is synthesized in the plastids.
3. C. Cytokinins are synthesized from adenine nucleotides and dimethylallyl diphosphate in the mitochondria.
4. D. The oxidative reactions that convert xanthoxin to abscisic acid occur in the cytosol.
5. E. Cytochrome P450 monooxygenase enzyme family associated with endoplasmic reticulum catalyzes most of the reactions in brassinosteroid biosynthesis.

Which one of the following combinations contains all correct statements?

1. 1A, C, D and E
2. 2A, B, D and E
3. 3B, C and D
4. 4A, B and E only