Every Molecular Biology (Fundamental Processes) question CSIR-NET Life Sciences has set in its last 11 papers, sorted by topic, with 16 of them solved step by step. Answers follow NTA’s final answer keys.
Unit 3 of the CSIR-NET Life Sciences syllabus, Fundamental Processes, is molecular biology: DNA replication, repair and recombination; transcription and RNA processing; translation and protein processing; and the control of gene expression in prokaryotes and eukaryotes. We went through all 11 papers from February 2022 to June 2025 and pulled out every question from this unit. It is one of the four biggest units in Parts B and C.
How much of the paper is Molecular Biology?
Across the 11 papers, 126 of the 1,375 Part B and Part C questions (9.2%) came from Unit 3. That ranks it fourth of the 13 units. 72 of the 126 were 4-mark Part C questions.
| Paper | Part B | Part C | Total |
|---|---|---|---|
| June 2025 | 4 | 6 | 10 |
| December 2024, Shift 1 | 6 | 5 | 11 |
| December 2024, Shift 2 | 5 | 5 | 10 |
| June 2024, Shift 1 | 5 | 5 | 10 |
| June 2024, Shift 2 | 4 | 8 | 12 |
| December 2023, Shift 1 | 4 | 7 | 11 |
| December 2023, Shift 2 | 6 | 8 | 14 |
| June 2023, Shift 1 | 5 | 6 | 11 |
| June 2023, Shift 2 | 6 | 6 | 12 |
| February 2022, Shift 1 | 6 | 8 | 14 |
| February 2022, Shift 2 | 3 | 8 | 11 |
| All 11 papers | 54 | 72 | 126 |
Which Molecular Biology topics come up most
DNA Replication, Repair & Recombination and Control of Gene Expression together account for 60% of the unit’s questions.
16 solved Molecular Biology PYQs
One or two from each major subtopic, from different papers. Try each one before you open the solution.
During replication, over-winding of DNA is caused by ____ and removed by ____.
- 1primase, topoisomerase
- 2primase, single stranded binding protein
- 3helicase, gyrase
- 4helicase, DNA polymerase
Show answer and solution
As the replicative helicase separates the strands, the twist it removes piles up ahead of the fork as positive supercoils (over-winding). In bacteria, DNA gyrase (a type II topoisomerase) removes them by cutting both strands and introducing negative supercoils, using ATP. Primase only makes RNA primers, and SSB only coats single strands.
What is the correct order of enzyme actions during the long-patch base excision repair in humans?
- 1Glycosylase, Lyase, AP endonuclease 1, DNA Polβ, DNA Ligase 3
- 2Glycosylase, AP endonuclease 1, DNA Polδε, Flap endonuclease 1, DNA Ligase 1
- 3Glycosylase, AP endonuclease 1, DNA Polβ, Flap endonuclease 1, DNA Ligase 1
- 4Glycosylase, AP endonuclease 1, DNA Polδε, Flap endonuclease 1, DNA Ligase 3
Show answer and solution
All base excision repair starts with a DNA glycosylase removing the damaged base, after which APE1 nicks the abasic site. In the long-patch branch, Pol δ/ε (with PCNA) displaces 2–10 nucleotides as a flap, FEN1 cuts the flap off, and DNA ligase I seals the nick. Short-patch BER instead uses Pol β and ligase III–XRCC1.
Which one of the following proteins is essential for both the initiation of DNA replication as well as the continued advance of the replication fork?
- 1ORC
- 2Geminin
- 3Cdc45
- 4Cdc6
Show answer and solution
Answer: (3) Cdc45
Cdc45, with GINS, joins the MCM2–7 ring to form the CMG helicase, so origins cannot fire without it. It also travels with the fork as part of that helicase, so it is needed for elongation too. ORC and Cdc6 act only when origins are licensed, and geminin blocks re-licensing.
The ColE1 plasmid has a low to medium copy number. However, pUC18, which is also a ColE1-based plasmid, has a high copy number because:
- 1It has a mutation in RNAI (antisense RNA) and does not carry the rop gene.
- 2It has a mutation in RNAII (primer for replication initiation) and does not carry the rop gene.
- 3It has a mutation in RNAI and the rop gene is overexpressed.
- 4It has a mutation in RNAII and the rop gene is overexpressed.
Show answer and solution
Answer: (2) It has a mutation in RNAII (primer for replication initiation) and does not carry the rop gene.
ColE1 replication starts from the RNA II primer and is held in check by the antisense RNA I, with help from the Rop protein. pUC plasmids have lost rop and carry a point mutation in RNA II that weakens its pairing with RNA I, especially at 37–42 °C. With weaker negative control, the copy number rises to several hundred per cell.
Which one of the following exhibits ATPase and helicase activities for promoter opening and clearance?
- 1TFIID
- 2TFIIH
- 3TFIIF
- 4TFIIE
Show answer and solution
Answer: (2) TFIIH
TFIIH is the only general transcription factor with enzymatic activities. Its XPB subunit is a DNA-dependent ATPase/helicase that opens the promoter. Its CDK7 kinase phosphorylates Ser5 of the Pol II CTD, which helps promoter clearance. TFIID binds the core promoter, TFIIF escorts Pol II, and TFIIE recruits TFIIH.
Which one of the following statements depicts the correct function of TFIIB?
- 1It binds to the TATA box and helps in the proper positioning of RNA pol II.
- 2It plays an important role in the elongation phase of transcription.
- 3It forms the transcription initiation complex by interacting with RNA pol II and TBP.
- 4It acts as a coactivator that facilitates the binding of enhancers to the promoter.
Show answer and solution
Answer: (3) It forms the transcription initiation complex by interacting with RNA pol II and TBP.
TFIIB binds TBP on the TATA box and contacts RNA polymerase II, bridging the two. It helps choose the start site. So it builds the initiation complex (option 3). TBP, not TFIIB, binds the TATA box (option 1), and TFIIB is released early rather than acting in elongation.
The tri-snRNP particle is composed of:
- 1U1, U4 and U3 snRNPs
- 2U2, U4 and U3 snRNPs
- 3U3, U6 and U5 snRNPs
- 4U4, U6 and U5 snRNPs
Show answer and solution
Answer: (4) U4, U6 and U5 snRNPs
The U4/U6·U5 tri-snRNP joins the spliceosome after U1 and U2 have recognised the 5′ splice site and the branch point. U4 then unwinds from U6, freeing U6 to pair with U2 and form the catalytic core. U3 is a snoRNA that works in rRNA processing, not mRNA splicing.
A DNA molecule is completely transcribed into messenger RNA by an RNA polymerase. The base composition of the DNA template strand is G = 24.1%; C = 18.5%; A = 24.6%; T = 32.8%. The base composition of the newly synthesized RNA molecule is:
- 1G = 24.1%, C = 18.5%, A = 24.6%, U = 32.8%
- 2G = 24.6%, C = 24.1%, A = 18.5%, U = 32.8%
- 3G = 18.5%, C = 24.1%, A = 32.8%, U = 24.6%
- 4G = 32.8%, C = 24.6%, A = 18.5%, U = 24.1%
Show answer and solution
Answer: (3) G = 18.5%, C = 24.1%, A = 32.8%, U = 24.6%
RNA is complementary to the template strand. Template G (24.1%) gives RNA C. Template C (18.5%) gives RNA G. Template A (24.6%) gives RNA U. Template T (32.8%) gives RNA A. So the RNA is G 18.5%, C 24.1%, A 32.8% and U 24.6%: option 3.
In bacteria many of the tRNA genes do not contain the CCA sequence found at the 3’ end of tRNA. In this context which one of the following statements represents the correct explanation?
- 1In these tRNAs amino acylation occurs at the 3’ end of the tRNA irrespective of the presence of the – CCA sequence.
- 2CCA sequence is added to these tRNA transcripts in a DNA template independent manner.
- 3These tRNAs exploit the process of trans- splicing to include a CCA sequence at their 3’ end.
- 4The absence of CCA sequence occurred only in the last common ancestor (LCA) during the course of evolution and the current day tRNA genes always possess a sequence to encode the CCA end of the tRNA.
Show answer and solution
Answer: (2) CCA sequence is added to these tRNA transcripts in a DNA template independent manner.
The 3′ CCA end is added after transcription by tRNA nucleotidyltransferase (the CCA-adding enzyme). It uses CTP and ATP and needs no DNA template. In E. coli some tRNA genes encode the CCA, but the enzyme still adds it where it is missing or repairs it after damage. Aminoacylation needs the terminal adenosine.
Introns in the eukaryotic genes are found in:
- 1rRNA and mRNA encoding genes but not in the tRNA encoding genes.
- 2mRNA and tRNA encoding genes but not in the rRNA encoding genes.
- 3mRNA encoding genes but not in the tRNA and rRNA encoding genes.
- 4rRNA, tRNA and mRNA encoding genes.
Show answer and solution
Answer: (4) rRNA, tRNA and mRNA encoding genes.
Eukaryotic introns occur in all three classes of genes. Most protein-coding (mRNA) genes are interrupted by spliceosomal introns. Many tRNA genes carry a short intron next to the anticodon, removed by a tRNA splicing endonuclease and ligase. Some rRNA genes have self-splicing group I introns, the classic case being the 26S rRNA of Tetrahymena.
Which one of the following translation factors is used at the step of translation initiation and defined as anti-association factor for 30S and 50S subunit interactions?
- 1IF1
- 2IF2
- 3IF3
- 4RRF
Show answer and solution
Answer: (3) IF3
IF3 binds the 30S subunit at the interface and keeps it from joining the 50S subunit too early. That makes the pool of free 30S subunits available for initiation, and IF3 also checks that the start codon pairs correctly with fMet-tRNA. IF1 blocks the A site, IF2 is the GTPase that brings fMet-tRNA, and RRF works at termination.
Which one of the following codons is used to code for selenocysteine in Escherichia coli?
- 1UGA
- 2UAA
- 3UAG
- 4UCC
Show answer and solution
Answer: (1) UGA
Selenocysteine, the “21st amino acid”, is encoded by UGA, normally a stop codon. In E. coli a stem-loop just downstream of the UGA (the SECIS element) recruits the special elongation factor SelB carrying Sec-tRNASec, so this UGA is read as selenocysteine instead of stop.
Which one of the following translation systems is inhibited by cycloheximide?
- 170S ribosome-associated bacterial translation system
- 280S ribosome-associated eukaryotic cytosolic translation system
- 374S ribosome-associated mitochondrial translation system
- 470S ribosome-associated chloroplast translation system
Show answer and solution
Answer: (2) 80S ribosome-associated eukaryotic cytosolic translation system
Cycloheximide binds the E site of the 60S subunit and blocks translocation, so it inhibits only 80S cytosolic ribosomes of eukaryotes. Bacterial, mitochondrial and chloroplast ribosomes are of bacterial type and are resistant. They are instead sensitive to chloramphenicol, which is why the two drugs are used to tell the systems apart.
Which of the following is a co-translational amino acid modification, rather than a post-translational modification?
- 1Phosphate added to a serine.
- 2Selenium added to a cysteine.
- 3Acetyl added to a lysine.
- 4Methyl added to an arginine.
Show answer and solution
Answer: (2) Selenium added to a cysteine.
Selenocysteine is not made by modifying a finished protein. Serine is loaded onto tRNASec and converted to selenocysteine on the tRNA, then inserted during translation. That makes it co-translational. Phosphorylation of serine, acetylation of lysine and methylation of arginine are all post-translational.
Some cells possess peptides which contain D- form of amino acids. How do they arise?
- 1These peptides are produced by ribosomes by incorporating D- amino acids at specific positions.
- 2Ribosome makes peptides with L-amino acids only. However, some of the amino acids in the peptides are replaced by D- amino acids by a pathway that involves excision of the L- amino acids.
- 3The peptides with the D-amino acids are produced in a ribosome-independent manner.
- 4Peptides with D-amino acids exist only in archaea where they are made by the presence of racemases.
Show answer and solution
Answer: (3) The peptides with the D-amino acids are produced in a ribosome-independent manner.
Ribosomes accept only L-amino acids. Peptides with D-amino acids, such as gramicidin, the cyclosporin precursors and bacterial cell-wall peptides, are mostly made by non-ribosomal peptide synthetases. These large modular enzymes carry epimerisation domains that convert L to D on the enzyme. So the peptides are made ribosome-independently.
A mutation in which one of the following sigma factors may be a possible cause for E. coli failing to adapt in response to thermal stress?
- 1σ70
- 2σ32
- 3σ54
- 4σ45
Show answer and solution
Answer: (2) σ32
σ32 (RpoH) directs RNA polymerase to heat-shock promoters, switching on chaperones (DnaK, GroEL) and proteases when the temperature rises. Without it, E. coli cannot mount a heat-shock response. σ70 is the housekeeping factor and σ54 controls nitrogen-regulated genes.
All 126 Molecular Biology questions, by subtopic
Each link opens the question on its full paper page. Press Show answer and solution there to see NTA’s final key and a worked solution.
DNA Replication, Repair & Recombination (44 questions)
| Paper and question | Part | Question |
|---|---|---|
| Jun 2025, Q21 | B | Which one of the following enzymes can unwind short stretches of DNA helix immediately ahead of a replication fork? |
| Jun 2025, Q92 | C | The figure below is a schematic representation of the replication fork. The different proteins associated with DNA replication are marked… |
| Dec 2024 S1, Q24 | B | Match the columns: Which one of the following options represents all correct matches between Column X and Column Y? |
| Dec 2024 S1, Q57 | B | Two types of mutant E. coli were identified: in the hypermethylation mutant (type A), DNA is methylated at the GATC sequences as soon as… |
| Dec 2024 S1, Q91 | C | The helicase activity of E. coli DnaB was investigated using the following two substrates (I and II) under various conditions, followed by… |
| Dec 2024 S2, Q26 | B | What is the correct order of enzyme actions during the long-patch base excision repair in humans? |
| Dec 2024 S2, Q34 | B | Match the following: Which one of the following options represents all correct matches between Column X and Column Y? |
| Dec 2024 S2, Q94 | C | In order to determine the origin of replication of a circular DNA, isolated DNA from the actively replicating cells were digested with… |
| Dec 2024 S2, Q122 | C | To study different DNA double-strand break (DSB) repair pathways, a construct is developed that contains a neomycin selectable marker gene… |
| Jun 2024 S1, Q42 | B | What is the correct order in which the following proteins are recruited during DNA double strand break repair in prokaryotes? |
| Jun 2024 S1, Q82 | C | In order to investigate the involvement of the following proteins in the mismatch repair mechanism (MMR), an in vitro reconstitution… |
| Jun 2024 S1, Q108 | C | A complete retroposon was cloned under the entire galactose inducible promoter. The construct, as shown below, was inserted in the yeast… |
| Jun 2024 S1, Q137 | C | DNA polymerase PolA has high fidelity but low processivity and DNA polymerase PolB has low fidelity and high processivity. In vitro… |
| Jun 2024 S2, Q35 | B | Topoisomerase activity was measured in terms of change in the linking number of DNA in the presence of Camptothecin (inhibitor of… |
| Jun 2024 S2, Q82 | C | Asynchronous cultures of E. coli were grown in 14N and then shifted to 15N medium containing a chemical C (0 minute) and incubated for two… |
| Jun 2024 S2, Q86 | C | A uniformly labelled (32P) single-stranded DNA (ssDNA) was incubated with a homologous double-stranded DNA (dsDNA) in the presence of Rad51… |
| Jun 2024 S2, Q91 | C | Single-stranded DNA binding properties of three DNA repair proteins (A, B, and C) were investigated. A biotinylated single-stranded DNA was… |
| Dec 2023 S1, Q29 | B | During replication, over-winding of DNA is caused by ____ and removed by ____. |
| Dec 2023 S1, Q86 | C | Following statements were made about rolling circle mechanism of replication. Which one of the following options shows the combination of… |
| Dec 2023 S1, Q117 | C | A mutant strain of E. coli having defects in one of the DNA repair pathways was identified. To identify the pathways where mutation… |
| Dec 2023 S2, Q25 | B | Which one of the following statements about human transposons is INCORRECT? |
| Dec 2023 S2, Q31 | B | Which one of the following statements about clamp loader is NOT correct? |
| Dec 2023 S2, Q77 | C | Following statements were made about supercoiling of DNA: Which one of the following options is a combination of all correct statements? |
| Dec 2023 S2, Q83 | C | The following DNA molecules are provided as substrates for replication by DNA polymerase III. Which one of the following options lists the… |
| Dec 2023 S2, Q86 | C | Following statements are made about DNA base excision repair (BER): Which one of the following options shows combination of all correct statements? |
| Jun 2023 S1, Q25 | B | Which one of the following statements about LINEs present in the human genome is TRUE? |
| Jun 2023 S1, Q32 | B | Which of the following statements about site-specific recombinases is NOT true? |
| Jun 2023 S1, Q83 | C | The following statements are made about the E. coli SOS response to DNA damage: Which one of the following options represents the… |
| Jun 2023 S1, Q84 | C | The following statements are made about telomeres: Which one of the following options represents the combination of all correct statements? |
| Jun 2023 S1, Q87 | C | The following statements refer to factors regulating the fidelity of DNA replication. Which one of the following options gives the… |
| Jun 2023 S2, Q27 | B | A bacterial culture initiated from a single bacterial cell with a DNA repair- deficient system is inoculated into several individual test… |
| Jun 2023 S2, Q83 | C | A mutant DNA polymerase was found to have higher error rate and synthesized only short DNA fragments. In the statements below, potential… |
| Jun 2023 S2, Q84 | C | Column X lists proteins that play a role in mediating DNA recombination processes and Column Y lists the possible functions of these… |
| Feb 2022 S1, Q32 | B | Which one of the following proteins is essential for both the initiation of DNA replication as well as the continued advance of the replication fork? |
| Feb 2022 S1, Q51 | B | The basic difference between direct repair and base excision repair is |
| Feb 2022 S1, Q78 | C | Which one of the following is valid with respect to, one step growth experiment developed by Ellis and Delbruck in 1939? |
| Feb 2022 S1, Q86 | C | Reproduction of ϕ×174, a single stranded DNA phage involves several steps. A few statements are given below to explain the mechanism… |
| Feb 2022 S1, Q89 | C | The following statements are made with reference to DNA replication: Which one of the following options represents all correct statements? |
| Feb 2022 S1, Q115 | C | A group of transposable elements described as ‘retroelements’ encompass |
| Feb 2022 S1, Q132 | C | Given below are graphs depicting two possible dynamics of gene duplication events over a period of time during genome evolution. Based on… |
| Feb 2022 S2, Q25 | B | Which one of the following statements about Short Interspersed Nuclear Elements (SINEs) is TRUE? |
| Feb 2022 S2, Q32 | B | Given below are a set of enzymes in Column A and enzyme activities in Column B. Choose the option that matches the contents of column A… |
| Feb 2022 S2, Q80 | C | Following statements were made about transposons: Which one of the following represents the combination of the correct statements? |
| Feb 2022 S2, Q87 | C | In the figure above, replication of DNA beginning from the origin of replication of the chromosome of a newly identified bacterium having a… |
Control of Gene Expression (32 questions)
| Paper and question | Part | Question |
|---|---|---|
| Jun 2025, Q81 | C | The activity of two promoters (A and B) upstream of a luciferase reporter in response to transcription factor TF-X in a cell line was… |
| Jun 2025, Q100 | C | Eukaryotes regulate gene expression via histone modifications. In the table given below, the histone modification (column X), its… |
| Dec 2024 S1, Q34 | B | The majority of modifications on histone molecules happen at their ______ |
| Dec 2024 S1, Q98 | C | Given below are different types of genetic manipulations of E. coli trp operon (Column X) and their consequences on its transcription… |
| Dec 2024 S1, Q116 | C | A lac-lambda hybrid system is developed to study the λ-repressor protein, in which the λ CI gene is under the control of E. coli lac… |
| Dec 2024 S1, Q129 | C | The following statements were made regarding the roles of histone modifications in transcriptional regulation. Which one of the following… |
| Dec 2024 S2, Q49 | B | Which one of the following statements about DNA packaging in chromosomes is INCORRECT? |
| Dec 2024 S2, Q73 | C | A region of a mouse chromosome was subjected to micrococcal nuclease hypersensitivity analysis over stages of development. In early stages… |
| Dec 2024 S2, Q137 | C | Match the following bacterial gene expression mechanisms: Which one of the following options represents all correct matches between Column… |
| Jun 2024 S1, Q24 | B | Which one of the following statements for the lac operon in E. coli is INCORRECT? |
| Jun 2024 S1, Q36 | B | In eukaryotes, nucleosome remodelers |
| Jun 2024 S1, Q107 | C | URA3 gene expression allows yeast cells to grow on synthetic media lacking Uracil (SC-URA). Shown below are cell types having URA3 gene… |
| Jun 2024 S2, Q29 | B | Which one of the statements about bacterial operons is INCORRECT? |
| Jun 2024 S2, Q39 | B | The trp operon can be induced by the addition of indole propionic acid (IPA), which binds to the trp repressor but does not allow the… |
| Jun 2024 S2, Q83 | C | Protein A binds the mRNA for gene B in HeLa cells. The protein A mediates the formation of mRNA-protein particles (mRNPs). The addition of… |
| Jun 2024 S2, Q92 | C | Given below is a list of regulatory RNAs (Column X) and their modes of action (Column Y). Which one of the following options represents all… |
| Jun 2024 S2, Q103 | C | Eukaryotic transcription factors TF1 and TF2 bind to independent cis regulatory elements (Cis1 and Cis2, respectively) upstream of TATA box… |
| Jun 2024 S2, Q104 | C | A region of a eukaryotic chromosome is heavily transcribed by RNA polymerase-II. Given below are a few properties of such a chromatin… |
| Jun 2024 S2, Q134 | C | Following are a few statements made regarding the lac operon. Which one of the following options represents the combination of all correct statements? |
| Dec 2023 S1, Q80 | C | The statements below attempt to describe a few characteristics of Alu repeats found in the human genome Which one of the following options… |
| Dec 2023 S2, Q87 | C | Two teams of researchers (I and II) extracted chromatin from nuclei and examined them with an electron microscope. The Team I found that… |
| Jun 2023 S1, Q85 | C | The LacI and TrpR repressors bind with their ligands allolactose and tryptophan respectively, resulting in alteration of their DNA binding… |
| Jun 2023 S1, Q86 | C | Bacteriophage λ and P1 are both temperate phages. Which one of the following statements made about these phages and their lytic and… |
| Jun 2023 S2, Q25 | B | In a lac operon, a nonsense mutation in the gene encoding beta-galactosidase was found to interfere with the expression of downstream… |
| Jun 2023 S2, Q31 | B | The ColE1 plasmid has a low to medium copy number. However, pUC18, which is also a ColE1-based plasmid, has a high copy number because: |
| Jun 2023 S2, Q86 | C | Bacteriophage λ proteins, CI and Cro are crucial regulators of the lysogeny and lytic cycles of the bacteriophage. These proteins bind to… |
| Feb 2022 S1, Q33 | B | Which one of the following combinations represents the major protein or protein complex involved in chromatin condensation in yeast and… |
| Feb 2022 S1, Q85 | C | Given below are a few statements about the λ infection cycle Which one of the following options represents all correct statements? |
| Feb 2022 S2, Q77 | C | Following statements were made about stress response in prokaryotes: Which one of the following represents the correct combination of above… |
| Feb 2022 S2, Q83 | C | The following statements are made with reference to the structure of the nucleosome: Which of the following combinations represents all… |
| Feb 2022 S2, Q84 | C | The following observations are being made in the context of the regulation of iron homeostasis in mammalian cells. Based on these… |
| Feb 2022 S2, Q85 | C | A heterozygote of E. coli was produced with the following combination of mutations: trpR+trpO−trpE+/trpR+trpO+trpE− where R is the… |
RNA Synthesis & Processing (29 questions)
| Paper and question | Part | Question |
|---|---|---|
| Jun 2025, Q43 | B | A transcript of a gene is shown below, with lines showing introns and rectangles showing exons. A mutation from ‘T’ at the 6th nucleotide… |
| Jun 2025, Q55 | B | Which of the following chemical modifications of uridine residue occur after transcription of tRNA? |
| Jun 2025, Q60 | B | Which one of the following statements depicts the correct function of TFIIB? |
| Jun 2025, Q144 | C | The primary sequence of a miRNA is given below. 5′ – UAGCUUAUCAGACUGAUGUUGA – 3′ The seed region of miRNA starts from the 2nd position to… |
| Dec 2024 S1, Q54 | B | Which one of the following statements about RNA polymerase in eukaryotes is INCORRECT? |
| Dec 2024 S2, Q70 | B | In the context of gene expression, what is the primary function of the mediator complex in eukaryotes? |
| Dec 2024 S2, Q143 | C | In a study, researchers replaced the natural promoter of a gene with a synthetic promoter that contains a point mutation in the TATA box… |
| Jun 2024 S1, Q40 | B | A DNA molecule is completely transcribed into messenger RNA by an RNA polymerase. The base composition of the DNA template strand is G =… |
| Jun 2024 S2, Q62 | B | A yeast strain has accumulated a mutation that makes it grow slowly. Investigation reveals that ribosomal RNA levels have dropped… |
| Dec 2023 S1, Q30 | B | P-bodies are discrete cytoplasmic collections of RNAs and proteins that are involved in: |
| Dec 2023 S1, Q32 | B | RNA polymerase is an enzyme that transcribes DNA sequences into RNA. Which one of the following is NOT a property of the RNA polymerase? |
| Dec 2023 S1, Q83 | C | Following statements were made about mRNA splicing: Which one of the following options shows combination of all correct statements? |
| Dec 2023 S1, Q84 | C | Given below is the structure of a gene whose transcription is terminated in a Rho-independent manner. When the terminator is operational… |
| Dec 2023 S2, Q23 | B | Which one of the following options represents parts of a tRNA that are involved in amino acid charging and interaction with the mRNA, respectively? |
| Dec 2023 S2, Q29 | B | Which one of the following exhibits ATPase and helicase activities for promoter opening and clearance? |
| Dec 2023 S2, Q30 | B | The tri-snRNP particle is composed of: |
| Dec 2023 S2, Q72 | C | Which one of the sequences given below is a portion of a potential microRNA precursor? |
| Dec 2023 S2, Q84 | C | Various types of processed eukaryotic endogenous mRNA are mentioned below: Choose the option that identifies all the mRNA species that can… |
| Dec 2023 S2, Q88 | C | As depicted in the figure below, the sequence of trypanosomal mitochondrial cytochrome oxidase subunit II (COX II) mRNA does not match the… |
| Jun 2023 S1, Q29 | B | Which one of the following mRNAs is most likely to be exported out of the nucleus? |
| Jun 2023 S2, Q29 | B | In eukaryotic genes, DNA sequences that define gene promoters occur: |
| Jun 2023 S2, Q30 | B | Introns in the eukaryotic genes are found in: |
| Jun 2023 S2, Q32 | B | Which one of the following statements about TATA Binding Protein (TBP) is NOT true? |
| Jun 2023 S2, Q85 | C | The following statements are made about post-transcriptional processing: Which one of the following options represents the combination of… |
| Feb 2022 S1, Q29 | B | In bacteria many of the tRNA genes do not contain the CCA sequence found at the 3’ end of tRNA. In this context which one of the following… |
| Feb 2022 S1, Q31 | B | All of the following statements about bacterial transcription termination are true EXCEPT |
| Feb 2022 S1, Q87 | C | Which one of the following schematics depicts the potential relationship among the subunits IIo, IIa, and IIb of RNA polymerase II? |
| Feb 2022 S2, Q30 | B | A mutation in which one of the following sigma factors may be a possible cause for E. coli failing to adapt in response to thermal stress? |
| Feb 2022 S2, Q88 | C | Which one of the following statements is NOT a correct feature of Escherichia coli RNA polymerase? |
Protein Synthesis & Processing (21 questions)
| Paper and question | Part | Question |
|---|---|---|
| Jun 2025, Q97 | C | The ability to unwind RNA substrates I and II by translation regulator ‘X’ was studied. RNA substrates with radiolabeled antisense strand… |
| Jun 2025, Q132 | C | The table below describes the effect of various antibiotics on protein translation in bacteria. Which one of the following options… |
| Dec 2024 S1, Q31 | B | A novel organism synthesizes proteins using ribosomes from the C-terminal end to the N-terminal end rather than the usual direction (N- to… |
| Dec 2024 S1, Q50 | B | Which one of the following modifications in their native system does NOT lead to translation inhibition? |
| Dec 2024 S1, Q80 | C | The mRNA of the E. coli lac operon contains the open reading frames for lacZ, lacY, and lacA genes from a single cistron. It is observed… |
| Dec 2024 S2, Q61 | B | Which one of the following translation systems is inhibited by cycloheximide? |
| Jun 2024 S1, Q55 | B | Which one of the following does NOT occur during ribosome-associated quality control of damaged mRNA? |
| Jun 2024 S1, Q116 | C | The ratio of total protein content to total RNA content was measured in yeast cells in log phase during growth in minimal media and in… |
| Dec 2023 S1, Q31 | B | Which one of the following functions is NOT facilitated by a tmRNA? |
| Dec 2023 S1, Q85 | C | Following statements were made about initiation of translation in eukaryotes. Which one of the following options shows combination of all… |
| Dec 2023 S1, Q87 | C | A portion of an mRNA encoding a protein is shown below, with the start codon underlined. 5′…CCUCAAACAGACACCAUGUUGCACCUGACUCCU…3′ Which one… |
| Dec 2023 S2, Q32 | B | Which of the following is a co-translational amino acid modification, rather than a post-translational modification? |
| Dec 2023 S2, Q85 | C | The eukaryotic mRNA shown schematically in the diagram below has five ribosomes carrying out translation. Which one of the following… |
| Jun 2023 S1, Q30 | B | Which one of the following translation factors is used at the step of translation initiation and defined as anti-association factor for 30S… |
| Jun 2023 S1, Q31 | B | Which one of the following codons is used to code for selenocysteine in Escherichia coli? |
| Jun 2023 S1, Q88 | C | Which one of the following statements is correct in the context of erythromycin-mediated inhibition of protein synthesis in bacteria? |
| Jun 2023 S2, Q87 | C | The aminoacyl-tRNA synthetases (AARSs) in an organism have evolved to catalyze aminoacylation of their cognate tRNAs |
| Jun 2023 S2, Q88 | C | Following statements are made about the bacterial ribosomes and their functions: Which one of the following options represents the… |
| Feb 2022 S1, Q30 | B | Some cells possess peptides which contain D- form of amino acids. How do they arise? |
| Feb 2022 S1, Q84 | C | Mitochondrial protein synthesis is of prokaryotic origin. Following statements are being made about the ribosomes from bacteria and… |
| Feb 2022 S2, Q86 | C | Precise recognition of tRNAs by their cognate aminoacyl-tRNA synthetases is crucial for the fidelity of protein synthesis. In the context… |
PYQs for every CSIR-NET unit
How to revise Molecular Biology with these questions
- Start with the two biggest subtopicsDNA Replication, Repair & Recombination and Control of Gene Expression are where most of the marks have been. Revise them first.
- Attempt before you readWork through a subtopic’s questions on paper, then check them against the answer keys.
- Find the repeatsThe same ideas keep coming back in new wording. When you get one wrong, look for its earlier version in the list above.
- Finish with a full paperTake a whole paper in live exam mode to practise choosing which Part C questions to attempt.
Keep going
<
p class=”lbq-src”>Source: CSIR-NET Life Sciences question papers and final answer keys, National Testing Agency, February 2022 to June 2025. Subtopic tags, difficulty ratings and solutions: Lesson Basket.
